Лечение стоматита перекисью водорода: народные средства лечения. Видео — www.wday.ru


Снижение осложнений и риска рецидивов при лечении острого герпетического стоматита Текст научной статьи по специальности «Клиническая медицина»


Атаханов А.А.

Атаханов Азизбек Абдисаломович — ассистент, кафедра терапевтической, ортопедической и детской стоматологии, Андижанский государственный медицинский институт, г. Андижан, Республика Узбекистан

Аннотация: в данной статье рассматривается снижение осложнений и риска рецидивов при лечении острого герпетического стоматита у детей путем оптимального назначения антисептических средств. На данном этапе работы нами установлено, что частота осложнений зависит от применяемого лечения. I группе применили антисептические средства, применяемые по стандарту в стоматологической поликлинике — перекись водорода и раствор фурацилина. Частота осложнений в полости рта при этом составила 75,0%. II группе применялась комбинация раствора хлоргексидина биглюконата и мирамистина. В данной группе этот показатель равен 46,9%.

Ключевые слова: перекись водорода, герпетического стоматит, антисептические средства.

Актуальность. На сегодняшний день рынок предлагает огромный выбор антисептиков, обладающих различными свойствами и составом. Они могут оказывать влияние на состояние полости рта, а именно на эпителий. Важным требованием, предъявляемым к антисептическим средствам является их бактериостатическая и бактерицидная способность. Однако, в литературе имеются сведения о том, что данные вещества могут вызывать повреждения слизистых оболочек, при этом не оказывая должного антисептического действия[2]. В связи с этим, актуальным является вопрос изучения воздействия антисептиков на эпителий слизистой оболочки полости рта. Воспалительные заболевания пародонта среди основных стоматологических заболеваний представляют собой серьезную проблему в практике врача стоматолога, что обусловлено высокой распространенностью, сложностью своевременной диагностики и лечения, а также реабилитации больных [1,4]. В настоящее время подавляющее большинство исследователей признают, что у пациентов с данными заболеваниями обнаруживается дисбаланс факторов местного иммунитета полости рта [2,3,5]. В зависимости от тяжести клинической ситуации ухудшаются и показатели местного иммунитета, то есть имеется прямая корреляция между ними [6].

Цель настоящего исследования: изучить частоту осложнений в полости рта при использовании антисептическими средствами мирамистина и хлоргексидина на слизистую оболочку полости рта .

Материалы методы исследования. В исследовании приняли участие 48 пациентов, которые были условно разделены на две группы. В группе №1 применяли антисептик — хлоргексидин, в группе №2 — мирамистин. Для изучения биоэлектрических характеристик эпителия слизистой оболочки был применен метод микроэлектрофореза.

Результаты и обсуждения. В ходе исследования обнаружилось, что в группе №1 наблюдались признаки паранекроза клеток (отсутствие биоэлектрических реакций ядра и других структу клеток, отдельные гиперхромные очаги, смещение ядра). В группе №2 наблюдалось незначительное торможение жизненной активности клеток и отсутствие гиперхромного окрашивания и смещение ядра. При оценке микробиоценоза полости рта проведили соскоб буквального эпителия до и после медикаментозной обработки полости рта антисептиками, после проводился посев на желточно-солевой агар. После

орошения полости рта в группе №1 роста не наблюдалось, а в группе №2 значение КОЕ составило 10-1.

Выводы: Результаты полученных данных позволяют предположить наличие у антисептического препарата мирамистин мирамистин-индуцированного воздействия на эпителиальные клетки слизистой оболочки и нейтрофилы в полости рта, что способствует восстановлению основных параметров местного иммунитета и взаимосвязей между ними. Таким образом, хлоргексидин в отличии от мирамистина существенно снижает адаптацию эпителиальных клеток, что проявляется в уменьшении показателей биоэлектрических свойств мембран и микрокоагуляции белка, что может быть обусловлено более выраженным токсическим воздействием хлоргексидина. Однако, следует заметить, что мирамистин оказывает менее выраженные антисептические свойства. Данный факт позволяет рекомендовать антисептик мирамистин к более широкому применению в лечении и профилактике воспалительных заболеваний пародонта как препарат, повышающий иммунореактивность местного иммунитета, что в дальнейшем влияет на качество лечения и частоту рецидивов.

Список литературы

1. БелозеровЕ.С., БуланьковЮ.И. Болезни герпесвирусной группы. Элиста., 2005. 64 с.

2. Рабинович О.Ф., Рабинович И.М., Разживина Н.В. Рецидивирующий герпетический стоматит. М., 2005. 64 с.

3. Мельниченко Э.М., Плотников Ю.В. Прогнозирование рецидивирующего герпетического стоматита у детей с помощью вычислительных таблиц // Стоматология. 1984. № 2. С. 65-68. [2]

4. Рабинович О.Ф., Рабинович И.М., Разживина Н.В. Рецидивирующий герпетический стоматит. М.: Гоэтар-Медиа, 2005. 64 с.

5. Stan G. Improving the outcome of facial resurfacing-prevention of herpes simplex virus type 1 reactivation // J. Antimicrob. Chemother. 2001. № 47. P. 29-34.

6. AndredM.E., Prober Ch. // Herpes. 2003. Vol. 2. P. 32-37.

7. SpotswoodL., Spruance S.L., HillS. // S. Antimicrob. Chemother. 2004. Vol. 53. P. 703-707.


Рахмонова Феруза Муталибовна — ассистент, кафедра терапевтической, ортопедической и детской стоматологии, Андижанский государственный медицинский институт, г. Андижан, Республика Узбекистан

Аннотация: в данной статье рассматривается снижение осложнений и риска рецидивов при лечении острого герпетического стоматита у детей путем оптимального назначения антисептических средств. На данном этапе работы нами установлено, что частота осложнений зависит от применяемого лечения. I группе применили антисептические средства, применяемые по стандарту в стоматологической поликлинике — перекись водорода и раствор фурацилина. Частота осложнений в полости рта при этом составила 75,0%. II группе применялась комбинация раствора хлоргексидина биглюконата и мирамистина. В данной группе этот показатель равен 46,9%.

Ключевые слова: перекись водорода, герпетического стоматит, антисептические средства.

стоматит лечение перекисью водорода — 17 рекомендаций на Babyblog.ru

Не ожидала что столкнусь с ним так быстро, у старшего его не было, поэтому заболевшая им Настя немного выбила меня из колеи.. сегодня приходила участковая и подтвердила мои предположения — герпесный стоматит..

накопала тут немного информации, вдруг пригодится кому…

Другим широкораспространенным видом стоматита является острый первичный герпетический стоматит. Заболевание относится к одному из многочисленных клинических проявлений первичной герпетической инфекции. В настоящее время на острый герпетический стоматит приходится более 80 % случаев всех заболеваний слизистой оболочки полости рта у детей. Ранее это заболевание описывалось под названием «острый афтозный стоматит».

Герпетический стоматит — острое инфекционное заболевание, возбудителем которого является вирус простого герпеса, широко распространенный в природе. Вирус передается контактным или воздушно-капельным путем. Источник инфекции — больной человек и вирусоноситель. Острым герпетическим стоматитом болеют дети в возрасте от 6 месяцев до 3 лет. После трехлетнего возраста первичное инфицирование встречается все реже, но заболевают первично и взрослые. Очень часто первичное инфицирование бессимптомно. Вирус обычного герпеса, попав в организм, сохраняется в нем на всю жизнь.

Острый герпетический стоматит протекает по типу классического инфекционного заболевания с пятью периодами развития: инкубационный (длится от 2 до 21 дня), продромальный, разгара болезни, угасания и клинического выздоровления. По тяжести заболевания различают легкую, среднетяжелую и тяжелую формы.

Заболевание начинается остро, как правило, с повышения температуры (от 37 oC при легкой форме до 40—41 oC при тяжелой) и общего недомогания. В полости рта наблюдается интенсивное покраснение, воспаление и кровоточивость десен, слюнотечение и запах изо рта. Через 1—2 дня возникает боль в полости рта, которая усиливается при еде и разговоре, на слизистой высыпают одиночные или сгруппированные элементы в виде толстостенных пузырьков (везикул) или участков поверхностного некроза эпителия. Стадия везикулы быстро переходит в эрозию-афту. Локализуются афты преимущественно на небе, языке, щеках, губах. У больных отмечается также воспаление подчелюстных лимфоузлов. На коже лица иногда наблюдаются типичные герпетические высыпания в виде сгруппированных пузырьков с прозрачным содержимым.

При легкой форме заболевания в течение 2 суток после образования афт наступает полная эпителизация элементов поражения, температура тела нормализуется, улучшается аппетит. Кровоточивость и воспаление десен могут сохраняться еще в течение 1—3 суток, а воспаление лимфоузлов еще дольше.

Среднетяжелая форма афтозного стоматита имеет четко выраженные симптомы интоксикации (слабость, раздражительность, плохой аппетит), отмечается поражение слизистой оболочки полости рта во все периоды болезни. При этой форме стоматита высыпания в полости рта могут быть многоразовыми и сопровождаться ухудшением общего состояния ребенка.

Тяжелая форма острого герпетического стоматита в настоящее время встречается несколько чаще, чем 10—15 лет тому назад. У ребенка отчетливо выраженные симптомы интоксикации (апатия или раздражительность). Могут наблюдаться тошнота и рвота центрального происхождения. Элементы поражения в результате сливания образуют обширные очаги некроза. Сравнительно длительное время сохраняются кровоточивость десен и явления лимфаденита.

Ребенка с острым герпетическим стоматитом необходимо изолировать. Комната не должна быть ярко освещена — это раздражает больного. Рекомендуется отдельная посуда, полотенце, показано обильное питье, так как дети теряют много жидкости вследствие обильного слюнотечения. Лечение должно быть комплексным (общим и местным). Местное лечение применяется с целью снятия или ослабления болезненных симптомов в полости рта, а также для быстрейшего отторжения некротизированных тканей и последующей эпителизации очагов поражения. В домашних условиях можно обрабатывать полость рта ватным тампоном, смоченным в отваре лекарственных трав, или проводить орошение полости рта растворами антисептиков (риванолом, фурацилином, калия перманганатом, перекисью водорода) каждые 3—3,5 часа.

С первых дней развития заболевания показано применение противовирусных мазей (0,5%-ные флореналевая, теброфеновая, оксолиновая, бонафтоновая, 50%-ная интерфероновая). После освобождения слизистой оболочки от некротических масс следует назначать средства, способствующие эпителизации (масло шиповника, облепихи, персиковое, льняное, сок каланхоэ, каратолин, препарат «Винизоль»). Всем больным показано также назначение антигистаминных препаратов (супрастин, диазолин, тавегил, фенкарол, глюконат кальция) в сочетании с аскорбиновой кислотой.

При среднетяжелой форме целесообразны средства, стимулирующие защитные силы организма (нуклеинат натрия, метилурацил, лизоцин).

При тяжелой форме стоматита необходима госпитализация ребенка с проведением интенсивной терапии.


лечение стоматита перекисью водорода

Ключевые теги: лечение гастрита подорожником в домашних условиях, где купить лечение стоматита перекисью водорода, сода против изжоги рецепт.

комплекс лечения язвы желудка, хронический колит лечение, лечение диареи у собак в домашних условиях, какое лечение при колите кишечника, схема лечения гастрита с пониженной кислотностью

Что такое лечение стоматита перекисью водорода

У меня хронический бронхит. Каждую осень переживаю обострение. Сейчас начала пить пихтовый вар. Хорошее средство, кашель проходит намного быстрее. 100% Пихтовый вар СИЛА ТАЙГИ – натуральное и эффективное средство для оздоровления всего организма независимо от возраста. Очень полезен и взрослым и детям. Средство не продается в аптеках и магазинах. Количество для продажи на официальном сайте ограничено.

Официальный сайт лечение стоматита перекисью водорода


Перекись водорода при стоматите один из самых действенных препаратов для лечения начальной стадии заболеваний. h3O2 можно смело использовать в терапевтических целях патологий полости рта и взрослым и детям. Перекись водорода – проверенное десятилетиями средство, использующееся для дезинфекции и антисептической обработки ран. Может ли помочь перекись водорода при стоматите? Содержание: 1 Свойства перекиси. Лечение стоматита перекисью водорода. 5 (100%) 1 vote. Перекись водорода при стоматите применяется довольно активно. Препарат представляет собой жидкость, лишенную цвета и запаха. Перекись водорода при стоматите у взрослых Использование перекиси водорода при лечении стоматита у взрослых. Стоматит лечение перекисью водорода. Оглавление. 1 Как лечить стоматит в домашних условиях у взрослых народными средствами. 2 Полоскание. 3 Особенности лечения. Перекись водорода при стоматите: можно ли обрабатывать язвы и полоскать рот? Средство не имеет запаха и цвета. Перекись водорода — жидкость, которая моментально разлагается при взаимодействии с бактериями. Стоматит лечение перекисью водорода. Стоматит – это комплекс различных болезней слизистой оболочки полости рта. Для заболевания характерно появление мелких болезненных язвочек или ранок. Описание препарата. Перекат водорода – это бюджетный вариант лечения стоматита. Для него характерны следующие свойства: Дезодорирующее; Кровоостанавливающее; Антисептическое; Дезинфекционное. При лечении стоматита у взрослых перекись водорода используют перед нанесением гелей и мазей. Это делается с целью очищения ротовой полости. У детей показанием к обработке полости рта перекисью водорода является возраст до 6 лет. Все препараты в современной медицине, рассчитаны для. Одним из простых и действенных методов лечения заболеваний ротовой полости считается перекись водорода при стоматите, которую можно применять даже детям грудного возраста. Лечение стоматита перекисью водорода проводят следующим образом — полоскания полости рта проводят не реже пяти раз в день, причем лечение перекисью нужно применять до того момента.

Результаты испытаний

Если у Вас случился неприятный инцидент с обслуживающим персоналом, Вы можете оставить жалобу не только на официальном сайте recept-znaharya.ru, но и здесь. Представитель организации ответит на Ваш отзыв и примет меры по улучшению качества предоставляемых услуг. У меня начался гастрит. Я люблю кушать гамбургеры, пиццу и всякое такое. Вот и допустила до болезни. Случайно нашла на этом сайте Пихтовый вар Сила Тайги. Понравилось мне, что состав полностью из травок. Заказ приехал очень быстро, и я сразу начала лечение. Где-то за месяц применения почувствовала облегчение. Желудок, поджелудочная в порядке. Всем рекомендую.

Мнение специалиста

Уникальный лечебный сбор имеет богатейшую формулу. Его основу составляет хвоя пихты сибирской. Добытая в чистейшей местности, в определенное время, собранная вручную, высушенная по особой технологии – она самый ценный компонент вара. Ее непревзойденный эффект на слизистую и работу ЖКТ в целом, использовали еще в Древней Руси. Вар помогал проводить чистку кишечника, справляться с болевым синдромом, устранять воспаления, заживлять раны, оздоравливать организм. Для более эффективного действия в состав средства входят лекарственные травы.

Как быстро остановить понос, хорошо знает народная медицина. Применение народных средств при диарее не только уместно, но и очень эффективно. При этом некоторые способы не требуют ни затрат, ни больших усилий. Диарея – это расстройство пищеварения, которое. Прием лекарства позволит быстро остановить понос, чтобы добраться до дома и продолжить лечение. Препараты антибактериального действия. Они эффективны и необходимы в случаях, когда симптоматика обусловлена влиянием инфекции. Как остановить понос, диарею у взрослого, препараты, таблетки, методы и способы. Когда в самый неподходящий момент начинает крутить живот, а затем начинаются позывы к дефекации, появляется частый жидкий стул или даже понос, можно попасть в очень неприятную ситуацию. Понос чаще всего. Быстро остановить острую диарею поможет препарат Смекта. Как остановить понос народными средствами у взрослого? Восстановить моторику кишечника поможет крепкий черный чай. Очень важно подобрать нужный препарат, способный быстро остановить диарею. Для этого следует понять, почему возникло подобное состояние. При непонятных причинах длительного расстройства стула необходимо обратиться к врачу. Основные принципы антидиарейной терапии у взрослого: Предупреждение. Все описанные препараты могут быстро вылечить и остановить диарею, но нужно понимать, что таблетки и другие средства можно. Зная, как остановить понос у взрослого, применяя только лекарства, еще потребуется ознакомиться с тем, как вылечить диарею народными средствами в домашних условиях. Как быстро остановить сильный понос у взрослого?. Необходимо такое средство, которое остановит диарею в кратчайшие сроки, чтобы вновь появилась возможность жить полноценной жизнью. Рассмотрим как остановить диарею в домашних условиях у взрослых быстро и безопасно. Средства экстренной помощи. На тот случай, когда у взрослого развилась диарея и ее необходимо остановить в кратчайшие сроки врачи рекомендуют иметь в аптечке такие препараты: Сорбенты. К примеру, Смекта. Остановить внезапно начавшуюся диарею помогают остановить также препараты, оказывающие. Выясняя, как остановить диарею в домашних условиях у взрослых быстро и безопасно, следует обратить внимание на народные методы. Лечение, препараты. Как остановить понос у взрослого в домашних условиях. Список самых дешевых лекарств от диареи. Быстро остановить понос у взрослого можно при помощи отваров лекарственных трав, обладающих вяжущими свойствами (дуб красильный) и снимающими боли и спазмы. Противомикробные средства — основная группа препаратов в лечении инфекционной диареи, направленная на устранение причины заболевания и как результат — на купирование симптомов. Понимание причины возникновения диареи поможет быстро остановить понос и восстановить нарушенное пищеварение. Используя медикаментозные препараты при домашнем лечении поноса, внимательно изучайте инструкцию перед их применением. Учтите все имеющиеся противопоказания и не допускайте. Как остановить понос с помощью лекарственных препаратов? Самым результативным средством от диареи считается. Многие люди, не желая мучиться от этого недуга, начинают интересоваться, как быстро остановить понос. Помогут в этом такие таблетки, как Лоперамид или Лопедиум. Таблетки от поноса – обзор лучших препаратов при диарее. Схема терапии зависит от того, чем вызвана данная проблема. Диарея – причины. Перед тем как остановить диарею, важно правильно определить причину, которой она. Как остановить понос медикаментами и народными средствами. Диарея является симптомом ряда заболеваний. Понос – это увеличение количества и разжижение каловых масс, характеризующееся частыми позывами к дефекации.

Способ применения

Высокое содержание биологически активных веществ экстракта пихтового, легко устраняет витаминозный голод организма. Экстракт пихтовый, оказывает регенерирующее, антимикробное воздействие на организм. Не влияет на полезную микрофлору и поддерживает баланс минеральных веществ в организме. Нормализует обмен веществ. Подавляет воспаление, снимает симптомы интоксикации и диспепсии. Связывает и выводит аллергены, токсины, свободные радикалы. Является гипатопротектором, усиливает моторную функцию кишечника. Способствуют обогащению и питанию клетки, сокращая витаминное голодание организма.

Как лечить панкреатит. Мне выписал врач омез, мезим. Я расписала полный курс лечения панкреатита -лекарства надо принимать все которые указаны и именно в этой последовательности в течении 10-14 дней, лечение комплексное -спазмолитик из них это дюспатолин принимается 2 раза в день утро-вечер за 20. Схема лечения панкреатита формируется с учетом степени сложности и особенностей протекания заболевания. Воспаление поджелудочной железы бывает острым и хроническим. Форум больных панкреатитом. Панкреатит, лечение,симптомы, диагностика, питание, консультации специалистов, отзывы. Испытания пациентов с хроническим панкреатитом исследовали эффект аллопуринола ( в России есть такое лекарство). Аллопуринол, который, как полагают, уменьшает. Форум больных панкреатитом. Панкреатит, лечение,симптомы, диагностика, питание, консультации специалистов. В больницу я поехал через пару дней, и там мне ставят диагноз острый панкреатит. Назначают лекарства и садят на диету. В таком ритме я живу полгода, и вроде становится всё хорошо. Панкреатит панкреатиту рознь, кто то живет с этим без проблем долго и счастливо с редкими обострениями, а у кого то переходит. У меня хронический панкреатит. По началу, когда приступы были оч редкие, не обращала внимание. Какими препаратами лечить хронический панкреатит, группы медикаментов и названия. Эффективные лекарства при воспалении поджелудочной железы. Лечение хронического панкреатита препаратами. Содержание. Схема лечения. Обзор эффективных спазмолитиков. Ферментативные препараты. Возможные методы и схемы лечения панкреатита хронической стадии. На сегодняшний день гастроэнтерологи отмечают рост такого тяжелого заболевание, как хронический панкреатит. Обусловлено это многими факторами, которые не лучшим образом влияют на состояние поджелудочной железы. Лечение хронического панкреатита начинают с назначения диеты. Необходимо исключить из рациона употребление прием жареной, жирной, соленой и острой пищи. Страница закроется автоматически через 5 секунд. Закрыть. Форум: дети. Все темы: 9 248. Новое за сегодня. Лечение панкреатита лекарствами. Следует иметь в виду, что острый панкреатит относится к ургентным состояниям, и его. Важнейший пункт, который включает схема лечения панкреатита лекарствами, состоит в том, чтобы затормозить функциональную активность поджелудочной железы, то есть снизить. Схема лечения панкреатита лекарствами корректируется в зависимости от индивидуальных особенностей пациента, зависит от формы воспаления и его тяжести. Обязательные составляющие терапии панкреатита Особенности приема лекарств при панкреатите. Схему лечения должен назначить врач и разъяснить, какие лекарства для поджелудочной железы нужно пить после, какие – во время трапезы. Например, ферментные лекарства при панкреатите пьют одновременно с принятием пищи, тогда как антибиотики – после.

Как заказать?

Заполните форму для консультации и заказа лечение стоматита перекисью водорода. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении.

лечение стоматита перекисью водорода. гастрит с атрофией слизистой лечение. Отзывы, инструкция по применению, состав и свойства.

Официальный сайт лечение стоматита перекисью водорода

✅ Купить-лечение стоматита перекисью водорода можно в таких странах как:

Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина Армения

У меня хронический бронхит. Каждую осень переживаю обострение. Сейчас начала пить пихтовый вар. Хорошее средство, кашель проходит намного быстрее.

Осталась очень довольная от Пихтового отвара Сила тайги. Начала принимать вместе со всей семьей. Во-первых, очень нравится запах этого отвара, приятно пить. Во-вторых, сироп действительно повышает устойчивость к простуде, после того, как начала его принимать, я уже и не вспомню, когда болела последний раз. В-третьих, повысилась активность организма.Улучшение самочувствия были заметны уже через несколько дней.В общем, всем советую этот продукт, ведь самое главное, что он натуральный!

Позаботиться о своем здоровье и о здоровье близких нужно уже сегодня. Ведь завтра может быть поздно! Пихтовый вар СИЛА ТАЙГИ — это биологически активное вещество из пихты, изготавливаемое по старинному рецепту вдалеке от городов в экологически чистом регионе (предгорье Саян в Сибири) методом экстрагирования из молодых побегов пихты сибирской, с исключительными свойствами. Внешне это вещество темно-коричневого цвета, имеющее густую однородную консистенцию и характерный неповторимый хвойный аромат.

Перекись водорода от стоматита, особенности применения.

Перекись водорода – проверенное десятилетиями средство, использующееся для дезинфекции и антисептической обработки ран. Может ли помочь перекись водорода при стоматите?

Свойства перекиси

Средство представляет собой не имеющую запаха и цвета жидкость с химической формулой h3O2. Она содержит в два раза больше атомов кислорода, чем вода, и является сильным окислителем. Этим объясняется дезинфицирующая способность: кислород, вспениваясь, очищает даже глубокие отделы раны. Основные свойства препарата:

  • дезинфекция;
  • кровоостанавливающий эффект;
  • антисептическое действие;
  • удаление загрязнений с раневых поверхностей.

Препарат широко используется в медицине для обработки ран, лечения ЛОР-заболеваний. Еще одна сфера применения – косметология: средством можно отбелить зубы в домашних условиях, оно является составной частью косметических масок для лица.

Перекись содержит в два раза больше атомов кислорода, чем вода, и является сильным окислителем.

При стоматите препарат используется не как самостоятельное средство, а в составе комплексной терапии, для очищения полости рта перед нанесением лечебных гелей.

Применение у взрослых

При лечении стоматита используется только раствор, имеющий концентрацию 3%. В аптеках продается также 6-процентная перекись, однако она предназначается для обработки кожи. Средство применяется двумя способами:

  1. Полоскание. Для приготовления раствора столовая ложка разводится на стакан воды. Полоскать рот нужно на протяжении пяти минут, повторяя процедуру 5-6 раз за сутки.
  2. Примочки. Ватный тампон смачивается, прикладывается к язвочкам в полости рта. Для этого метода рекомендуется использовать препарат, имеющий концентрацию 0,25%.
При лечении стоматита используется только раствор, имеющий концентрацию 3%.

После обработки на протяжении 20 минут запрещается есть и пить. Важно следить, чтобы жидкость не попадала внутрь, во избежание ожога слизистой желудка.

Использование перекиси водорода при стоматите у ребенка

Сложность лечения заболевания у детей заключается в том, что они не могут самостоятельно прополоскать рот, поэтому этот метод исключается. Порядок очистки пораженной полости рта у грудничков следующий:

  1. Руки тщательно обрабатываются антибактериальным средством.
  2. Стерильная марля смачивается перекисью, наматывается на палец мамы.
  3. Пальцем нужно аккуратно провести по слизистой оболочке ротовой полости малыша.

Перед тем как применять описанную методику, необходимо проконсультироваться с педиатром.

Перекись используется для стнятия симптомов, но она не устраняет первопричину развития заболевания.

Дети старшего возраста (после 6 лет) могут самостоятельно полоскать рот. Важно объяснить им, что глотать раствор категорически нельзя. Если ребенок отказывается выполнять процедуру из-за неприятного привкуса, можно добавить раствор маленькую каплю эфирного масла.

Читайте также: «Обзор мазей от стоматита у взрослых: какие, когда и почему лучше применять?»


При наружном применении перекись водорода – полностью безопасный препарат, использование которого разрешено, в том числе, при беременности. Считается, что единственным противопоказанием к применению является индивидуальная непереносимость, которая встречается редко. Однако врачи рекомендуют проявлять осторожность также при следующих заболеваниях:

В отзывах пациенты называют перекись водорода универсальным средством, способным дезинфицировать раны, останавливать воспалительные процессы. Эта жидкость устраняет симптомы стоматита, но не влияет на его причины, поэтому ограничить терапию одной только перекисью нельзя. Она должна быть комплексной, назначенной врачом после диагностики, определившей главную причину заболевания.


  1. Терапевтическая стоматология. Под ред. Е.В. Боровского. Москва, 2004.
  2. Кильдиярова Р., Колесникова М. Справочник врача-педиатра. Москва, 2015.

Перекись водорода при стоматите, рецепты лечения

Доброе время суток! Меня зовут Халисат Сулейманова — я фитотерапевт. В 28 лет себя вылечила от рака матки травами (больше про мой опыт выздоровления и почему я стала фитотерапевтом читайте здесь: Моя история). Перед тем как лечиться по народным методам описанным в интернете, просьба, консультируйтесь со специалистом и лечащим врачом! Это сэкономит ваше время и деньги, поскольку заболевания разные, травы и методы лечения разные, а есть еще сопутствующие заболевания, противопоказания, осложнения и так далее. Пока добавить нечего, но если Вам нужна помощь в подборе трав и методик лечения, можете меня найти вот по контактам:

Халисат Сулейманова

Страничка Instagram: instagram.com/fitoterapevt1

Телефон:  8 918 843 47 72

Почта: [email protected] ru

Консультирую бесплатно.

Если у детей или взрослых появляются небольшие болезненные язвочки или воспаления слизистой оболочки в ротовой полости, то не исключено, что это может быть такое заболевание, как стоматит. Данный недуг можно лечить в домашних условиях, но для этого необходимо понять причину его возникновения. Ведь на сегодняшний день бывают разнообразные формы этого заболевания: кандидоз, вирусный, афтозный и т.д. С каждой формой болезни поможет справиться раствор пероксида. Перекись водорода при стоматите действует довольно эффективно, так как обладает мощными антисептическими свойствами, убивая всю патогенную микрофлору в зоне нанесения.

Основные причины возникновения недуга

Самой распространенной причиной является инфекция: вирусная, бактериальная или грибковая.

  1. У детей очень часто появляется именно грибковый (кандидозный) стоматит. В простонародье его еще называют молочницей.
  2. Также бывает, что возникает аллергический стоматит. Особенно это касается людей, которые склонны к аллергическим реакциям.
  3. Болезнь также появляется вследствие жизнедеятельности бактерий. Это, как правило, возникает тогда, когда не соблюдают правила гигиены, при травмах, неправильном положении зубных протезов или вследствие ослабления иммунитета.
  4. При воздействии вирусов может появиться герпетическая болезнь.
  5. Также заболевание может вызвать табачный дым или прием каких-либо лекарств.

Какая бы не была причина — обработка стоматита перекисью водорода поможет снять воспаление, снизит болевые ощущения и ускорит выздоровление.

Основные признаки

При возникновении болезни характерны следующие ее проявления:

  • повышается слюноотделение;
  • запах изо рта становится очень неприятным;
  • на слизистой оболочке появляются болезненные язвочки;
  • повышается температура тела;
  • повышается чувствительность языка;
  • при приеме пищи или разговоре можно чувствовать боль;
  • слизистая краснеет.

Применение перекиси водорода от стоматита

Самый простой способ лечить данный недуг — взять марлю, смочить ее в пероксиде, немного отжать. Далее, марлю обматываем вокруг пальца и тщательно проводим по всем воспаленным участкам ротовой полости. Процедуру нужно проводить 5-6 раз в день. Через неделю заболевание полностью исчезнет. Но при выборе раствора пероксида — берите 3% раствор. Так как средство с большей консистенцией может навредить слизистой оболочке.

Простые способы лечения сложных заболеваний:

Еще один хороший способ — полоскание перекисью при стоматите. В сети интернет, на форумах или тематических порталах люди часто задают одни и те же вопросы: можно ли полоскать и как полоскать рот перекисью водорода при стоматите? Полоскать ротовую полость раствором пероксида однозначно нужно. Средство обладает уникальным составом, который убивает все патогенные микробы, бактерии, грибки и вирусы. Которые и могли стать причиной возникновения такой болезни, как стоматит.

Но самое главное — для полоскания нужно сделать специальный раствор из 3% пероксида:

  • Берем стакан теплой кипяченой вода, заливаем в него 1 ч.л. перекиси.
  • Хорошо размешиваем и можем приступать к полосканию.
  • Полоскать нужно 2-3 минуты утром и вечером.

Важно также при полоскании не допускать попадания раствора в глотку. Ведь агрессивный раствор пероксида может нанести вред желудочно-кишечной микрофлоре. А это, безусловно, скажется на вашем самочувствии, так как способно вызвать раздражение пищевода, тошноту и рвоту.

Для того чтобы избавиться от неприятного послевкусия после полоскания достаточно пожевать 1-2 листика мяты.

Полезные статьи:

Перекись водорода при стоматите: полоскание, лечение

Автор Виктория Просмотров 201 Опубликовано Обновлено

Одним из простых и действенных методов лечения заболеваний ротовой полости считается перекись водорода при стоматите, которую можно применять даже детям грудного возраста. Такое средство считается совершенно безопасным, и применять его можно для полоскания рта либо смазывания образовавшихся язвочек. При начальной стадии стоматита избавиться от патологии можно без применения медикаментозной терапии, но только после консультации со специалистом.

Особенности патологии

Стоматит представляет собой заболевание слизистой ротовой полости, то есть поражаются щеки, десны, гортань и язык. Основной причиной развития такой болезни считается не соблюдение элементарных правил личной гигиены либо снижение защитных функций организма. Специалисты разделяют стоматит на два вида:

  • инфекционный;
  • неинфекционный.

Вызвать развитие патологии инфекционного характера может как несоблюдение правил гигиены, так и проникновение в организм человека вирусных инфекций и различных паразитов. Кроме этого, часто инфекционный стоматит развивается при недостаточном поступлении в организм витаминов и нарушении функционирования иммунной системы.

Не инфекционный стоматит чаще всего возникает по следующим причинам:

  1. ожоги и травмы слизистой;
  2. прием антибиотиков в течение длительного времени;
  3. различные химические и физические повреждения слизистой.

Характерными признаками такой болезни считается подъем температуры тела выше 38 градусов, появление резкой боли и ощущения жжения во рту, а также кровоточивость поврежденных участков. Следует знать, что опасность стоматита кроется в том, что при снижении защитных функций организма он быстро распространяется и поражает все новые части слизистой ротовой полости. При отсутствии эффективного лечения возможно развитие различных осложнений и даже заражение крови.

Свойства перекиси водорода

Для лечения стоматита часто применяется такое средство, как перекись водорода. Такой препарат представляет собой жидкость, у которой отсутствует запах и цвет. Перекись водорода обладает:

  • дезодорирующим
  • кровоостанавливающим;
  • антисептическим;
  • дезинфекционным свойством.

Кроме этого, лечение стоматита перекисью позволяет ускорить процесс заживления ран за счет химического взаимодействия белка и водорода.

В том случае, если заболевания ротовой полости диагностировано у взрослых, то перекись водорода применяется для обработки пораженных участков слизистой перед нанесением мазей и гелей. У детей таким средством можно лечить стоматит как сразу после рождения, так и в более старшем возрасте.

Перед началом лечения стоматита перекисью водорода следует проконсультироваться со специалистом. Такой препарат обладает дезинфицирующим действием, что позволяет ему быстро и успешно справляться с различными бактериями.

Применение перекиси водорода при болезни

Лечение стоматита перекисью водорода можно проводит двумя способами:

  1. Полоскание ротовой полости раствором различной концентрации, но чаще всего применяют 1% жидкость. Средство именно такой концентрации помогает избежать ожога ротовой полости;
  2. Проведение механической очистки марлевым тампоном, предварительно смоченным в растворе перекиси водорода. При таком методе лечения рекомендуется применять 0, 25% раствор.

Для получения быстрого положительного эффекта при лечении патологии ротовой полости необходимо правильно приготовить раствор для полоскания. Для этого в стакан теплой воды вливают 3–5 мл перекиси водорода и тщательно перемешивают. Важно помнить о том, что необходимо добавлять перекись в воду, но ни в коем случае не наоборот. Приготовленное средство необходимо использовать для полоскания рта, причем проводить процедуру следует таким образом, чтобы жидкость ни в коем случае не попала внутрь. Дело в том, что проникновение такого средства в пищеварительный тракт может спровоцировать его ожог и тем самым нанести серьезный вред здоровью.

Перед каждой процедурой необходимо готовить свежий раствор и проводить полоскание рта в течение 7–10 минут, периодически выплевывая жидкость. Такого количества времени вполне хватит для того, чтобы продезинфицировать слизистую ротовой полости. Для быстрого избавления от болезненных ощущений при стоматите и для ускорения процесса заживления образовавшихся ранок проводить процедуру полоскания перекисью водорода рекомендуется как можно чаще.

Принимать пищу и пить напитки после полоскания не разрешается в течение 30–40 минут. После проведения процедуры во рту может в течение некоторого времени сохраняться неприятный вкус. Для того, чтобы его избежать, рекомендуется добавлять в приготовленный раствор несколько капель эфирного масла мяты либо лимона. Проводить процедуру полоскания необходимо до тех пор, пока полностью исчезнут все язвочки во рту.

В том случае, если раствор перекиси водорода все же попадает в желудок, то в большинстве случаях возникает легкий ожог. Следует помнить о том, что опасность представляет поглощение слишком большого количества раствора, ведь в таком случае развивается ожог желудочно-кишечного тракта. Кроме этого, у пациента могут возникать приступы тошноты и рвоты, а также сильные раздражения кожи.

Несмотря на существующую опасность применения такого лекарственного средства, оно все равно широко применяется для лечения стоматита. Это объясняется его лечебным воздействием на пораженную слизистую и для скорейшего выздоровления пациента важно соблюдать все правила приготовления раствора для полоскания.

Лечение стоматита у детей

У грудных детей стоматит сопровождается отказом от груди и высоким подъемом температуры. Для того, чтобы в домашних условиях быстро и безболезненно избавить малыша от такого недуга достаточно иметь в аптечке стерильную вату и пузырек с перекисью водорода. Перед проведением обработки пораженной слизистой взрослому необходимо тщательно вымыть руки с антибактериальным мылом.

Подготовленный тампон следует смочить в растворе перекиси и обмотать им чистый палец. После этого необходимо провести пальцем по пораженным участкам слизистой в ротовой полости ребенка и освободить их от белого налета. Такую обработку следует проводить несколько раз в день, и с ее помощью дети в скором времени избавляются от неприятной симптоматики.

Такой способ лечения перекисью водорода может использоваться не только в детском возрасте, но и взрослых. Избавиться от стоматита у ребенка можно и с помощью полоскания, которое проводится специальным раствором из перекиси водорода и воды. Следует помнить о том, что жидкость не должна попадать внутрь детского организма.

Не совсем приятной стороной при лечении стоматита у детей считается неприятный привкус самого препарата. Специалисты рекомендуют после дезинфекции рта тщательно прополоскать рот ребенка чистой водой. Нередко после обработки слизистой перекисью водорода у детей и взрослых развивается рвота, что считается вполне нормальной реакцией.

Противопоказания к применению средства

Многие пациенты сомневаются в безопасности и эффективности перекиси водорода при лечении стоматита. На самом деле, при правильно подобранной дозировке и соблюдении всех правил полоскания она не причиняет человеку вредя.

Специалисты говорят о том, что такое лекарственное средство можно применять для лечения заболеваний ротовой полости даже женщинам во время беременности и кормления грудью.

Отказаться от полосканий ротовой полости перекисью водорода следует в следующих ситуациях:

  • возраст ребенка до 3 лет;
  • опасность развития аллергии на компоненты средства;
  • при диагностировании заболеваний в острой форме;
  • проведение антибактериальной терапии;
  • рецидив хронических патологий.

Лечение лишь одним раствором перекиси водорода может занять довольно много времени. Именно по этой причине рекомендуется применять комплексный подход в борьбе со стоматитом, то есть сочетать народные средства лечение с медикаментозной терапией.

Как лечить стоматит (язвочки во рту)?

Стоматит лечение у взрослых в домашних условиях

Стоматит у детей

Стоматит у детей лечение в домашних условиях

лечение псориаза перекисью водорода

лечение псориаза перекисью водорода

лечение псориаза перекисью водорода


Что такое лечение псориаза перекисью водорода?

Средство Psorix сразу очень понравилось тем, что не пересушивает кожу, наоборот питает ее и увлажняет. Гормонов препарат не имеет. Масло содержит мед, прополис, грязь мертвого моря и воск. Все достаточно безобидно и полезно, не считая аллергиков. Масло очень приятное, сладко пахнет, оставляет жирноватый блеск на коже. Липкости на теле не ощущается. Масло нежное, успокаивающее, я абсолютно комфортно себя чувствую, и спокойно жду полного впитывания. Покраснения и раздражения средство не вызывает. Спас выравнивает кожу, делает ее гладкой и мягкой. Блямбы проходят быстро, но от них, конечно, остаются пятна. Со временем тон кожи выравнивается. Зуд совсем не беспокоит, потому что я начинаю наносить масло на ранней стадии. Препаратом пользуюсь от 1 до 3 недель, в зависимости от степени проблемы. Процедуру делаю на ночь. Спиртное из рациона стараюсь исключить совсем. От него ужасные ухудшения всегда и просто высыпает везде.

Эффект от применения лечение псориаза перекисью водорода

Наверное, никогда не решилась бы заказать лекарство из интернета, если бы не такое огромное количество положительных отзывов. Рискнула, и не пожалела, до этого ни один препарат не работал так эффективно. Бляшки исчезли, кожа восстановилась, пропал зуд. Обязательно порекомендую это средство своей подруге, она давно ищет нечто подобное!

Мнение специалиста

средство Psorix лучше всего работает именно на начальной стадии, снимая воспаление, устраняя зуд и боль.

Как заказать

Для того чтобы оформить заказ лечение псориаза перекисью водорода необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:


Псориаз возникает по разным причинам. Чаще всего это происходит из-за эндокринных нарушений, частых стрессов, генетической предрасположенности, нарушения работы иммунной системы, приема некоторых лекарственных препаратов. Независимо от этиологии заболевания, масло «Psorix» от псориаза помогает за короткое время избавиться от неприятных проявлений и физического дискомфорта. Разработкой препарата занимались лучшие российские ученые совместно с дерматологами, подбирая компоненты, которые не только направленно действуют, но и дополняют друг друга. В результате в состав масла «Psorix» от псориаза входят следующие натуральные компоненты: прополис — продукт пчеловодства, который давно известен своими целебными свойствами. Он оказывает противовоспалительный и антибактериальный эффект, способствует быстрому заживлению пораженных тканей; Пальмовое масло — снимает воспаление и зуд, нормализует деятельность защитных механизмов организма; Пчелиный воск — создает защитную оболочку, предотвращает проникновение бактерий и инфекций в пораженные ткани; Пчелиный яд — оказывает противовоспалительной и заживляющее действие. Поддерживает иммунную систему; Мед — улучшает общее состояние здоровья, снимает зуд и воспаление.


В отличие от кортикостероидов и ретиноидов, Псорикс не содержит синтетических веществ. В его составе присутствуют только натуральные компоненты, которые обладают синергическими свойствами – усиливают терапевтическую активность других составляющих.

Из-за аллергии мне очень сложно подобрать лекарство от псориаза. Перепробовал множество новинок, но каждый раз сталкивался с побочными эффектами. Единственное средство, о котором у меня сложилось положительное мнение – Псорикс. Пользуюсь крем-гелем и каплями больше месяца, нежелательных реакций не было. Эффект же, напротив, очень явный: от сыпи на коже не осталось и следа. Обязательно повторю курс, чтобы с его помощью обезопасить себя от рецидивов. Где купить лечение псориаза перекисью водорода? средство Psorix лучше всего работает именно на начальной стадии, снимая воспаление, устраняя зуд и боль.
По отзывам, лечение псориаза перекисью водорода довольно эффективное и пользуется большой популярностью. . Перекись водорода относится к антисептикам. Средство используют в случаях ангины или стоматита. Лечение псориаза с помощью перекиси водорода в домашних условиях достаточно старый метод. Эта кожная болезнь входит в группу трудноизлечимых. Дерматологическое заболевание главным образом поражает поверхность эпидермиса, но бывают исключения, такие как ногтевой псориаз. Лечение псориаза с помощью перекиси водорода не является новым методом борьбы с этим неприятным заболеванием. Еще наши родители знали, что избавиться от внешних симптомов псориаза без особых проблем можно именно этим средством. Лечение псориаза перекисью водорода — это одна из новейших методик, ставшая популярной, благодаря своей эффективности. Лечебные свойства перекиси водорода известны с давних времен. Информация о том, насколько хорошо помогает перекись водорода от псориаза, давно перестала быть секретом. Отзывы об этом методе лечения успели оставить тысячи пациентов. Большинство из них остались довольны результатом. Почему аптечное средство эффек. Способы лечения псориаза перекисью водорода. Перекись водорода представляет собой оксидантную жидкость, хорошо растворимую в воде, эфирах и спиртах. Она имеет металлический привкус. Больные, занимающиеся лечением псориаза перекисью водорода, высказываются о высокой эффективности такого метода. . Перекись водорода — бесцветный жидкостный оксидант с привкусом металла и антисептическим действием. Контактируя с поврежденными участками эпидермиса и слизистых, вещество. В народной медицине лечение хронических кожных заболеваний, в том числе псориаза, с помощью перекиси водорода основано на противомикробных, кровоостанавливающих и отбеливающих свойствах препарата.

Наверное, никогда не решилась бы заказать лекарство из интернета, если бы не такое огромное количество положительных отзывов. Рискнула, и не пожалела, до этого ни один препарат не работал так эффективно. Бляшки исчезли, кожа восстановилась, пропал зуд. Обязательно порекомендую это средство своей подруге, она давно ищет нечто подобное!
лечение псориаза перекисью водорода
Средство Psorix сразу очень понравилось тем, что не пересушивает кожу, наоборот питает ее и увлажняет. Гормонов препарат не имеет. Масло содержит мед, прополис, грязь мертвого моря и воск. Все достаточно безобидно и полезно, не считая аллергиков. Масло очень приятное, сладко пахнет, оставляет жирноватый блеск на коже. Липкости на теле не ощущается. Масло нежное, успокаивающее, я абсолютно комфортно себя чувствую, и спокойно жду полного впитывания. Покраснения и раздражения средство не вызывает. Спас выравнивает кожу, делает ее гладкой и мягкой. Блямбы проходят быстро, но от них, конечно, остаются пятна. Со временем тон кожи выравнивается. Зуд совсем не беспокоит, потому что я начинаю наносить масло на ранней стадии. Препаратом пользуюсь от 1 до 3 недель, в зависимости от степени проблемы. Процедуру делаю на ночь. Спиртное из рациона стараюсь исключить совсем. От него ужасные ухудшения всегда и просто высыпает везде.
Применение урсодезоксихолевой кислоты при псориазе: обзор клинических случаев. . Таким образом, эффективное лечение псориаза зачастую является сложной задачей для дерматологов, ревматологов и врачей общей практики. Перспективным направлением в данной области является изучение влияния. Урсодезоксихолевая кислота не дает тератогенного и мутагенного и эффекта, что было определено при помощи испытаний, проводившихся на животных. Урсосан при псориазе. Лечение может продолжаться от полугода до нескольких лет. При лечении псориаза с помощью таблеток главной задачей является уменьшение количества высыпаний и достижение ремиссии. . Наиболее эффективным гепатопротектором является урсодезоксихолевая кислота. Ключевые слова: псориаз; ультразвуковая эхография; урсодезоксихолевая кислота; гопантотеновая кисло-та; нейтральные липиды. Псориаз – мультифакториальное заболева-ние, характеризующееся вовлечением в пато-логический процесс не только кожи, но и вну-тренних органов. Урсодезоксихолевая кислота – гидрофильная желчная кислота, которая наряду с хенодезоксихолевой используется в медицине как лекарственное средство для лечения печени и заболеваний желчного пузыря. Изобретение способа лечения псориаза (монотерапия симвастатином). Лечение псориаза Бродалумабом. . Новые подходы в патогенетеческой терапии псориаза урсодезоксихолевой и гопантотеновой кислотами. Урсодезоксихолевая кислота, взаимодействуя с хенодеоксихоловой кислотой . Еще раз повторяю-я не врач а такой же больной псориазом и другими разными . чтоб иметь какие то знания об устройстве организма и его лечении, надо поучиться лет несколько. А я другой ВУЗ заканчивал. <{POST_SNAPBACK}>. Урдокса, Урс, Урсодезоксихолевая кислота, Урсолив, Урсором Ромфарм . Эти препараты считаются инновациями в области лечения псориаза кожи. . Урсодеоксихолевая кислота абсорбируется из тонкой кишки за счет пассивной диффузии (около 90%), а в подвздошной кишке посредством. Консультация на тему — Псориаз — Здравствуйте! Мне 40 лет, с 17 лет болею псориазом. Не пью, не курю. Стараюсь придерживаться правильного режима питания. Сладкое, острое, копченое практически исключила из рациона. Урсодезоксихолевая кислота (УДХК) помогает улучшить показатели здоровья у пациентов с заболеваниями печени и желчевыводящих путей, развившимися на фоне прогрессирующего псориаза. К такому выводу пришла группа российских учёных по итогам своего нового исследования. Результаты научной работы.

Можно ли использовать перекись водорода при язве?

Согласно Американской академии оральной медицины , язвы во рту являются одной из наиболее распространенных проблем во рту, при этом более половины населения испытывает язвы в течение своей жизни. Вы, наверное, слышали о многих домашних средствах для лечения этих надоедливых поражений. Следует ли использовать перекись водорода при язве?

Что такое язвы?

Язвы — это небольшие круглые белые язвы, которые могут появиться внутри щек, на верхней или нижней части языка, на деснах, на мягком небе и внутри губ.Также известный как афтозный стоматит или афтозные язвы, у вас может быть несколько язв на протяжении всей жизни. Вспышка язвы обычно длится от семи до 10 дней, но по данным Национального института здоровья , для полного заживления может потребоваться до трех недель. Язвы могут проявляться в виде отдельной язвы или скоплений. Иногда группы поражений объединяются, образуя одну большую язву в течение вспышки.

Язвы часто путают с герпесом, но афтозные язвы не вызываются вирусом и не заразны.

Можно ли использовать перекись водорода для лечения язвы?

Да, вы можете использовать перекись водорода для лечения язвы. В обзоре Journal of Pharmaceutical Sciences and Research рекомендуется смешивать раствор, состоящий из половины перекиси водорода и половины воды. (Будьте особенно осторожны, чтобы не проглотить раствор.) Вы можете нанести раствор на рану язвы ватным тампоном, а затем нанести небольшое количество магнезиального молока. Вы можете повторять этот процесс три или четыре раза в день.Перекись водорода является антисептиком, а это означает, что она может уменьшить количество бактерий вокруг язвы. Молоко магнезии действует как болеутоляющее и может помочь быстрее зажить рану.

Что еще можно сделать с язвой?

Если в вашей аптечке нет перекиси водорода, существуют другие безрецептурные средства, которые могут помочь облегчить дискомфорт от язвы. Deutsches Arzteblatt International отмечает, что распространенные средства от язв во рту включают антисептики, противовоспалительные препараты и средства местного действия, обезболивающие во рту. Медицинский центр Херши штата Пенсильвания рекомендует избегать острой или горячей пищи, чтобы не вызывать боли во время заживления язвы. Вы также должны продолжать пользоваться зубной нитью и чистить зубы не реже двух раз в день и поддерживать чистоту области вокруг язвы.

В некоторых случаях избежать язвы не удастся. Журнал фармацевтических наук и исследований сообщает, что около 40 процентов людей в семейном анамнезе получали язвы язвы, а это означает, что генетика может сыграть свою роль.Другие факторы, которые могут быть причиной этих болезненных язв во рту:

  • Колебания гормонов
  • Напряжение
  • Побочные эффекты лекарств
  • Плохая диета с дефицитом железа и некоторых витаминов
  • Травмы рта, например, из-за неподходящих зубных протезов или ссадины от зубной щетки с жесткой щетиной

Проконсультируйтесь со своим врачом и стоматологом о том, как предотвратить язвы. Например, вы можете поработать со своим врачом, чтобы установить сбалансированную диету, а ваш стоматолог может отрегулировать посадку ваших зубных протезов.Если язвенная болезнь или какое-либо поражение ротовой полости длится более двух недель или мешает нормальной повседневной деятельности, посетите стоматолога или врача для полной диагностики.

Средств от язвы, которые действительно работают

Когда вы чувствуете боль при язве, есть средства, которые помогут облегчить дискомфорт и, возможно, ускорить процесс заживления. Попробуйте эти средства для лечения мелких язвочек в домашних условиях и без рецепта и знайте, когда вам следует обратиться к стоматологу по поводу этой проблемы.

Иллюстрация Брианны Гилмартин, Verywell

Морская вода и бикарбонат натрия

Смешайте 1 чайную ложку соли с 1 стаканом теплой воды. Полощите раствор во рту в течение 30 секунд, затем выплюньте раствор.

Помимо соли, в физиологический раствор можно добавить 1/2 чайной ложки пищевой соды (бикарбоната натрия). Сделайте пасту, смешав пищевую соду с небольшими каплями воды до густой консистенции. Используйте эту пасту, чтобы покрыть язвы язвы, что поможет облегчить боль.

Эти методы можно повторять столько раз, сколько необходимо. Физиологический раствор и бикарбонат натрия способствуют быстрому заживлению ротовой полости, мягко уменьшая щелочность и уменьшая количество бактерий во рту.

Раствор перекиси водорода

Смешайте одну часть перекиси водорода с одной частью воды. Используйте ватный тампон, чтобы нанести раствор непосредственно на язвы язвы. Не глотайте раствор. Перекись водорода — это антисептик, который помогает уменьшить количество бактерий во рту.Взаимодействие с другими людьми

Молоко магнезии

Молоко магнезии, часто используемое в качестве вспомогательного средства для облегчения запоров и как антацидное средство, представляет собой жидкую суспензию гидроксида магния. Наносите молочко с магнезией прямо на язвы язвы с помощью ватного тампона три-четыре раза в день.

Этот метод рекомендуется после использования раствора перекиси водорода. Молоко магнезии поможет уменьшить боль и ускорить процесс заживления.

Жидкий антигистаминный препарат

Жидкое лекарство от аллергии Бенадрил (дифенгидрамин) можно использовать в качестве полоскания рта путем смешивания одной части молока магнезии и одной части дифенгидрамина.Промыть раствором в течение одной минуты, затем полностью выплюнуть раствор. Постарайтесь не проглотить эту смесь.

Безрецептурные средства для ухода за полостью рта и полоскания

В отделе стоматологической помощи вашего супермаркета или аптеки есть несколько вариантов, отпускаемых без рецепта.

  • Антисептические ополаскиватели для полости рта содержат ингредиенты, предназначенные для заживления язв во рту за счет уменьшения количества бактерий во рту.
  • Средства для ухода за полостью рта, обезболивающие во рту, также полезны при лечении язвы.
  • Такие продукты, как гели, пасты и ополаскиватели , специально предназначенные для лечения язв во рту, могут облегчить боль и помочь ускорить процесс заживления.

При использовании безрецептурных продуктов важно строго следовать инструкциям производителя.

Когда обращаться к стоматологу для лечения

Язвы, которые классифицируются как большие или считаются герпетиформными, могут потребовать лечения у стоматолога.Обычные методы лечения включают пероральные лекарства и (редко) кортикостероиды.

Проконсультируйтесь со своим стоматологом, если язвы не заживают через 14 дней, сопровождаются лихорадкой или кажутся инфицированными.

Пероральные препараты

Лекарства, отпускаемые по рецепту, могут потребоваться для лечения серьезных язв, переросших во вторичные инфекции.

Суспензия тетрациклина (жидкость) может быть назначена с указанием подержать лекарство во рту от двух до пяти минут перед проглатыванием.Тетрациклин обычно не назначают детям, поскольку было показано, что он вызывает необратимое изменение цвета развивающихся зубов.

Зовиракс (ацикловир) — противовирусный препарат, который может быть назначен при наличии множественных очень болезненных язв.


В редких случаях кортикостероиды, такие как преднизон и дексаметазон, могут быть назначены для лечения язвы. Суспензия дексаметазона (жидкость) может быть назначена для полоскания рта с указанием полностью выплюнуть через определенное время.Взаимодействие с другими людьми

Слово от Verywell

Имейте в виду, что, хотя язвы и болезненны, язвы, как правило, заживают сами по себе. Используйте эти методы для облегчения состояния и обратитесь к стоматологу по поводу незаживающих язв.

Дополнительная антимикробная химиотерапия на основе фотолиза перекисью водорода для безоперационного лечения пародонтита средней и тяжелой степени: рандомизированное контролируемое исследование

Дизайн исследования

Это исследование было разработано как рандомизированное контролируемое, одинарное слепое, многоцентровое (одна университетская больница) и одна частная стоматологическая клиника) с дизайном разделенного рта для сравнения эффектов нехирургической пародонтальной терапии с фотолизом RD + H 2 O 2 с эффектами лечения RD + LDDS (где RD сопровождалась антимикробной терапией с LDDS) и только RD.Протокол исследования был одобрен Наблюдательным советом больницы Университета Тохоку (IRB; номер 153003) и IRB клиники Kouseikai Sone Clinic. Все субъекты были проинформированы об исследовании, получили подробное описание процедуры и подписали письменное согласие. Это исследование было проведено в соответствии с положениями сводных стандартов отчетности по испытаниям (CONSORT) и руководящими принципами надлежащей клинической практики (GCP). Кроме того, исследование соответствовало Хельсинкской декларации с поправками, внесенными в Форталезе, Бразилия, в 2013 году.Исследование было зарегистрировано в Реестре клинических исследований Центра медицинской информационной сети университетской больницы (регистрационный номер клинического исследования: UMIN000016791) 15 апреля 2015 г. Независимая комиссия по мониторингу данных и безопасности проверяла данные на протяжении всего исследования. Блок-схема CONSORT клинического исследования представлена ​​на рис. 2.

Рисунок 2

Блок-схема CONSORT для этого исследования.

Выбор пациентов

Пациенты с пародонтитом средней и тяжелой степени были набраны из стоматологической клиники университетской больницы Тохоку и частной стоматологической клиники (Sweden Dental Sendai, Sendai, Japan).В общей сложности 63 пациента согласились пройти оценку на соответствие критериям. Было проведено скрининговое обследование, включая зондирование всего рта и рентгенологическую оценку. Критерии включения были следующими: (i) возраст от 35 до 70 лет, (ii) наличие не менее 18 оставшихся зубов, (iii) диагноз хронического пародонтита от умеренной до тяжелой степени 34 , (iv) наличие хотя бы одного зуб с PPD от 6 до 8 мм, и v) BoP в двух или более квадрантах. Критериями исключения были следующие: (i) курильщики, (ii) получавшие лечение антибиотиками и / или поддесневую пародонтологическую терапию в течение предыдущих 12 недель, (iii) неконтролируемый диабет, (iv) наличие острых симптомов, (v) прием лекарств. влияющие на состояние пародонта (например,g., преднизолон, фенитоин, нифедипин или циклоспорин A) или (vi) беременность или кормление грудью.

Базовое обследование и рандомизированное распределение

Базовое обследование проводилось за одну неделю до поддесневого лечения, и следующие переменные были зарегистрированы одним исследователем в каждом учреждении, который был замаскирован для рандомизированного распределения на протяжении всего периода исследования: PPD, BoP и PlI 35 ; то есть один и тот же человек выполнил все базовые исследования в каждом учреждении.Зондирование проводилось с помощью ручного чувствительного к давлению пародонтального зонда (Gram Probe # 2, YDM, Tokyo, Japan) с силой приблизительно 0,2 Н в шести точках на зуб. На основании результатов базового обследования у каждого пациента были выбраны два или три тестовых зуба (по одному в каждом квадранте) с показателями 6 мм ≤ PPD ≤ 8 мм, BoP (+) и PlI ≤ 1. В результате в это исследование были включены 142 тестовых зуба. Из щечной, язычной, мезиальной и дистальной поверхностей каждого исследуемого зуба в качестве тестируемого участка рассматривалась поверхность с наиболее глубоким PPD.Третий моляр, дистальная поверхность второго моляра и любые участки с фуркацией были исключены. Вертикальная потеря костной ткани оценивалась по рентгенографическим изображениям, полученным при скрининговом обследовании, и разница ≥2 мм между альвеолярным гребнем и дном костного дефекта считалась вертикальной потерей костной ткани. Участки тестирования были случайным образом распределены в одну из трех групп обработки: Группа 1, RD + H 2 O 2 обработка фотолизом; 2 группа — лечение РД + ЛДДС; и Группа 3, только RD.Таким образом, испытуемые участки у пациента обрабатывались различными методами лечения, чтобы сравнить их эффекты у одного и того же человека (например, дизайн с разделенным ртом). Рандомизированное распределение было выполнено с использованием метода минимизации с использованием интерактивной системы веб-ответов, стратификации по молярам или немолярам, ​​сайтам с или без вертикальной потери костной массы, а также университетской клинике или частной клинике.

Протокол лечения

Пациенты были включены в программу гигиены полости рта до базового обследования.Во время двух отдельных посещений им были даны инструкции по гигиене полости рта для самостоятельного контроля зубного налета с помощью чистки зубов и межзубных промежутков с использованием межзубной щетки и / или зубной нити. При каждом посещении также выполнялась профессиональная наддесневая чистка. Базовое обследование проводилось через неделю после второго гигиенического посещения.

Через неделю после исходного обследования стоматологами, которые не были назначены в качестве исследователей, было проведено нехирургическое поддесневое лечение под местной анестезией.Один квадрант лечился за одно посещение, и лечение для всех квадрантов было завершено в течение 2 недель. Испытуемые зубы лечили одним из трех нехирургических методов лечения пародонта (фотолиз RD + H 2 O 2 , RD + LDDS или только RD) с использованием недавно разработанного устройства (RP-14, AZ. Co. Ltd, Сендай, Япония), а остальные зубы лечили с помощью обычного ультразвукового скейлера.

RP-14 был оснащен функциями ультразвукового скейлера и лазера непрерывного действия, излучающего свет с длиной волны 405 нм, а также системой подачи воды для уменьшения тепла, выделяемого при ультразвуковом масштабировании.Для устройства были изготовлены полый стальной наконечник скалера и одноразовая пластиковая оптическая направляющая (предназначенная для установки внутри наконечника скалера) (рис. 3). Группа 1 получала ультразвуковое РД с использованием устройства с полым наконечником из стали, скалера и 3% H 2 O 2 вместо водяного хладагента. Таким образом, лазерный свет и H 2 O 2 высвобождались с конца наконечника скейлера во время RD, что генерировало гидроксильные радикалы в результате фотолиза. Выходная мощность лазера была установлена ​​на уровне 50 мВт на наконечнике скалера с помощью измерителя мощности, содержащегося в устройстве.Группы 2 и 3 получали RD с использованием твердого типа, стального наконечника скалера и водяного хладагента. Наконечник скейлера цельного типа имел те же размеры, что и полый, но без полой конструкции. Как и в случае с обычным наконечником скалера, охлаждающая жидкость была выпущена из шейки. Во всех группах РД выполнялась до тех пор, пока оператор не посчитал достаточным, или до 7 мин. Группу 2 дополнительно обрабатывали LDDS с использованием геля хлорида миноциклина (Periocline, Sunstar Inc., Takatsuki, Япония), тогда как группа 3 не получала никакого противомикробного лечения.После того, как группа 2 получила RD, гель с антибиотиком вводили в пародонтальные карманы с помощью специального аппликатора, и нанесение геля повторялось один раз в неделю в течение трех последовательных недель (всего четыре приложения). Пациенты наблюдались в течение 12 недель после лечения. На протяжении всего периода исследования инструкции по гигиене полости рта и профессиональная наддесневая чистка выполнялись повторно при каждом посещении в зависимости от состояния гигиены полости рта каждого пациента.

Рисунок 3

Фотографии и иллюстрации устройства RP-14 ( a ), использованного в настоящем клиническом испытании для лечения пародонта ( b ).RP-14 оснащен ультразвуковым скейлером и лазерным устройством, излучающим свет с длиной волны 405 нм. Стальной наконечник скалера полого типа и одноразовый пластиковый оптический проводник использовались для лечения в Группе 1 (обработка корня + обработка фотолизом H 2 O 2 ). Лазерный луч мощностью 50 мВт и 3% H 2 O 2 выходит из конца наконечника скалера. В результате гидроксильные радикалы образуются в пародонтальном кармане во время обработки корня.

Во время лабораторных испытаний амплитуды вибрации полых и цельных наконечников скалера, приводимых в действие RP-14, а также обычного наконечника скалера, приводимого в действие промышленным ультразвуковым устройством для удаления зубного камня (Varios750, NSK, Kanuma, Japan), были измерены с помощью лазерного доплеровского виброметра (KV100-LM TYPE-D, Denshigiken, Yokohama, Japan) в соответствии со стандартами, предоставленными Японским комитетом по промышленным стандартам (JIS T 5750: 2009 «Стоматология — Стоматологические наконечники — Ультразвуковые инструменты и насадки для многоцелевое лечение »).Поскольку амплитуда обычного наконечника скалера, используемого в режиме лечения пародонта, составляла 25 мкм, амплитуда полого и твердого наконечников скалера была установлена ​​как эквивалентная. Частота обоих типов насадок для удаления зубного камня составляла 33 кГц, что также было установлено на основе частоты коммерческого ультразвукового инструмента для удаления зубного камня. Кроме того, интенсивность вибрации полых и сплошных наконечников скейлера, приводимых в движение RP-14, была оценена путем измерения потери веса пластины из акриловой смолы, подвергнутой ультразвуковому масштабированию с нагрузкой 3.5 Н в течение 10 мин. Тесты проводились с использованием пяти независимых анализов.

Микробиологический анализ

Отбор микробиологических проб проводился в тестовых участках непосредственно перед лечением (считается исходным уровнем для микробиологического анализа), а также через 1 и 4 недели после лечения ослепленными исследователями. Зона отбора проб была изолирована и высушена, а наддесневой налет был удален. Два стерильных бумажных штифта (№ 45, Spident, Инчхон, Корея) были вставлены в место проведения испытаний и удерживались на месте в течение 30 с, затем перенесены в стерильную пробирку и отправлены в контрактную лабораторию (BML, Токио, Япония).Количественную оценку общего количества бактерий и P. gingivalis (как репрезентативного пародонтального патогена) проводили с помощью модифицированного анализа Invader Plus с применением двухэтапной полимеразной цепной реакции 36,37 . Вкратце, ДНК экстрагировали с использованием коммерческого набора (MagNA Pure LC Total Nucleic Acid Isolation Kit; Roche, Базель, Швейцария). Праймер для P. gingivalis был разработан на основе геномной ДНК, кодирующей 16S рибосомную РНК (вперед: GCGCTCAACGTTCAGCCT, обратный: CACGAATTCCGCCTGCC).Аналогичным образом, первичный зонд и олиго-захватчик для P. gingivalis были сконструированы с использованием создателя технологии Invader (Hologic, Мэдисон, Висконсин, США) (первичный зонд: CGCGCCGAGGGGCAGTTTCAACGGC, олиго-захватчик: GCCGCCGCTGAACTCAAGCCCT). Кроме того, для расчета общего количества бактерий использовались пара универсальных праймеров (вперед: GGATTCGCTAGTAATCG, обратный: TACCTTGTTACGACTT) и универсальный зонд (первичный зонд: CGCGCCGAGGCCGGGAACGTATTCACC, олиго-захватчик: TGACGGGCGGTGTGTACAAGGCA). Целевую ДНК амплифицировали с помощью термоциклера (ABI PRISM 7900, Applied Biosystems, Foster City, CA, USA), и флуоресценцию детектировали в соответствии с протоколом, предоставленным производителем набора (набор основных реагентов Cleavase XI Invader, Hologic).

Последующее обследование

Клиническая оценка PPD, BoP и PlI проводилась слепыми экспертами через 4, 8 и 12 недель после лечения. Только пробные зубы были оценены на 4- и 8-недельном обследовании, тогда как полное обследование полости рта проводилось через 12 недель после лечения. Любые нежелательные явления, наблюдаемые в течение периода наблюдения, регистрировались. Тяжесть зарегистрированных нежелательных явлений оценивалась согласно NCI CTCAE v4.0.

Первичным исходом был PPD, зарегистрированный через 12 недель после лечения, а вторичными исходами были PPD через 4 и 8 недель, BoP через 4, 8 и 12 недель и количественное определение общего количества бактерий и P.gingivalis через 1 и 4 недели после лечения.

Расчет размера образца

Расчет размера образца был выполнен для определения количества тестовых участков, необходимых для демонстрации не меньшей эффективности лечения RD + H 2 O 2 обработки фотолизом по сравнению с обработкой RD + LDDS по отношению к первичной исход. Основываясь на предыдущих исследованиях, разница в средних значениях PPD между двумя группами составила 0,7 мм со стандартным отклонением 1,0 мм. Обеспечивает степень 80%, односторонний уровень значимости 2.5% и запас не меньшей эффективности 0,3 мм, необходимый размер выборки был рассчитан так, чтобы составлять 40 участков для каждой группы. Чтобы компенсировать потерю для последующего наблюдения, мы планировали включить 46 тестовых участков / группу (всего 138) от 55 пациентов. Когда на исходном уровне было зарегистрировано ≥46 участков в группе, набор прекращался, даже если количество пациентов было <55.

Статистический анализ

Статистический анализ данных, полученных в клиническом исследовании, проводился с использованием SAS версии 9.4 (SAS Institute, Cary , NC).Не меньшая эффективность лечения фотолизом RD + H 2 O 2 (Группа 1) по первичному результату (PPD при 12-недельном обследовании) по сравнению с лечением RD + LDDS (Группа 2) и превосходство лечения RD + H 2 O 2 лечение фотолизом по сравнению с одним только RD (группа 3) было статистически протестировано с использованием полного набора данных анализа (то есть анализа намерения лечить). Если была подтверждена не неполноценность, то дополнительно оценивалось превосходство. Общая линейная модель использовалась для определения разницы в среднем значении PPD при 12-недельном обследовании между группами.Измерение PPD моделировалось линейной функцией группы лечения, и мы предположили, что ковариационная структура сложной симметрии учитывает корреляции внутри субъектов. Когда нижний предел 95% доверительного интервала разницы между группами превышал -0,3 мм (предел не меньшей эффективности), группа 1 считалась не уступающей группе 2. Точно так же, когда нижние пределы 95% доверительного интервала для разница между группами была больше 0 мм, группа 1 считалась более высокой, чем группы 2 или 3.

Для вторичных конечных точек статистически значимые различия (P <0,05) между группами также оценивались с использованием общих линейных моделей для измерения PPD и общего количества бактерий и P. gingivalis и обобщенных линейных моделей для скорости ответа. платежного баланса. Была использована общая линейная модель со временем, группой лечения и термином взаимодействия между ними в качестве независимых переменных. Учитывая внутрипредметные и межвременные корреляции, была использована ковариационная структура, построенная путем взятия произведения Кронекера неструктурированной матрицы с дополнительной сложной матрицей симметрии.Анализы копий бактерий проводили с логарифмически преобразованными значениями. Кроме того, мы использовали обобщенную линейную модель со временем, группой лечения и термином взаимодействия между ними в качестве объясняющих переменных для скорости ответа от BoP. Функция связи была «идентичностью», и предполагалось, что неструктурированная ковариационная структура учитывает межвременные корреляции.

Что касается данных, полученных во время лабораторных испытаний, статистическая значимость (P <0,05) интенсивности ультразвуковой вибрации, создаваемой полыми и твердыми наконечниками скалера, была оценена с помощью теста Student t с использованием JMP Pro 11. .0.0 (SAS Institute).

Доступность данных

Наборы данных, созданные и / или проанализированные в ходе текущего исследования, доступны у соответствующего автора по разумному запросу.

Домашние средства от афтозной язвы или язвы

Домашние средства:

Морской раствор и бикарбонат натрия — Смешайте 1 чайную ложку соли с одним стаканом воды. Полощите раствор во рту в течение 30 секунд, затем выплюнуть раствор.Помимо соли, 1/2 чайной ложки пищевая сода (бикарбонат натрия) может быть добавлена ​​в физиологический раствор. Сделайте пасту, смешав пищевую соду с небольшими каплями воды до густая консистенция. Используйте эту пасту, чтобы покрыть язву, которая помочь облегчить боль. Эти методы можно повторять столько раз, сколько необходимо.

Раствор перекиси водорода — Смешайте одну часть перекиси водорода с одной частью воды. Используйте ватный тампон. нанести раствор прямо на язву.Не глотайте раствор. Перекись водорода — антисептик, который помогает уменьшить количество бактерии во рту.

Молоко магнезии — Часто используется в качестве вспомогательного средства при запоре и как антацидное средство, Молоко магнезии представляет собой жидкую суспензию гидроксида магния. Нанесите молоко магнезии прямо на язву ватным тампоном, от трех до четырех раз в день. Этот метод рекомендуется после использования перекиси водорода. решение.Молоко магнезии поможет уменьшить боль и ускорить процесс заживления.

Жидкий антигистаминный препарат Дифенгидрамин (Бенадрил) можно использовать в качестве полоскания для полости рта, смешав один часть молока магнезии и одна часть дифенгидрамина вместе. Промыть раствор в течение одной минуты, затем полностью выплюнуть раствор. Заботиться избегать проглатывания этой смеси.

500 мг L-лизина-. Прием от одного до трех раз в день оказался полезным.

Безрецептурные средства для ухода за полостью рта и ополаскиватели для полости рта -Продукты, такие как гели, пасты и ополаскиватели, которые специально продаются от язв может облегчить боль и ускорить процесс заживления.

(PDF) Эффективность местного применения трихлоруксусной кислоты и перекиси водорода при афтозных язвах

Gomal Journal of Medical Sciences июль-декабрь 2010 г., Vol. 8, No. 2 107

Трихлоруксусная кислота для местного применения при афтозных язвах

Тяжесть ожога зависит от ряда факторов, включая концентрацию

агента, продолжительность контакта, объем и

физическая форма агента, 8 Он также используется для

лечения острого наружного отита, 9 как гербицид,

и антисептик.10

h3O2 — бледно-голубая жидкость, имеющая цвет —

меньше в разбавленном растворе, немного более вязкая, чем

вода. Это слабая кислота. Он обладает сильными окислительными свойствами

и, следовательно, является мощным отбеливающим агентом

, который в основном используется для отбеливания бумаги, но

также нашел применение в качестве дезинфицирующего средства.11 Подача перекиси водорода

в раны убивает фибробласты

и закупоривает местные микрососуды. .12,13

Мы считаем, что нет необходимости лечить AUM

, если метод лечения потенциально опасен, как

стероиды или иммуномодуляторы, но является разумным

и стоит лечить, если польза от лечения —


, такое как неинвазивность, низкая стоимость и простота применения

, перевешивает его недостатки, и это

применимо к TCA.Наши результаты показали, что высокоэффективный 30% TCA

довольно хорошо соответствовал своим минимальным побочным эффектам

mal при лечении AUM.

Мы продемонстрировали новое лечение

без каких-либо серьезных побочных эффектов с использованием местного ТЦА. Показатель успешности местного лечения ТЦА

в нашем исследовании

может быть увеличен за счет увеличения концентрации агента, поскольку глубина повреждения ткани

увеличивается с концентрацией


Недостатком этого исследования был короткий период спуска

; длительное наблюдение может позволить нам пролить свет на рецидив



Трихлоруксусная кислота 30% является подходящим средством

при лечении малых афтозных язв. Он предлагает

преимущества низкой стоимости, отсутствия побочных эффектов,

и простоту применения и обращения.

принесет пользу пациентам, особенно в развивающихся странах с ограниченными ресурсами.

Терапевтический эффект h3O2 требует дальнейшего изучения

, включая использование различных концентраций.


1. Берджесс Дж. А., Джонсон Б. Д., Соммерс Э. Фарма-

Лечение рецидивирующей слизистой оболочки полости рта

Язвы на коже. Наркотики 1990; 39: 54-65

2. Фридберг IM. Дерматология Фитцпатрика в общей медицине. 5-е изд. Том 1. Нью-Йорк, Нью-Йорк:

McGrawHill, 1999.

3.Котран Р.С., Кумар В., Роббинс С.Л. Патология Роббинса

логическая основа болезни. 4-е изд. Филадельфия:

Сондерс, 1989: 817.

4. Чепмен М.С., Чимис Р.Дж., Баумэн Р.Д. Отсутствие ассоциации

между афтозными язвами и

Helicobacter pylori [Письмо]. Arch Dermatol 1998;

134: 1634-5.

5. Мальвия В.К., Деппе Г., Плющински Р., Бойке Г.

Трихлоруксусная кислота в лечении папилломавирусной инфекции шейки матки

без as-

-ассоциированной дисплазии.Obstet Gynecol 1987; 70:


6. Zhu WY, Blauvelt A, Goldstein BA, Leonardi C,

Penneys NS. Обнаружение с помощью полимеразы

цепная реакция ДНК ВПЧ в кондиломах

acuminata, обработанных in vitro жидким азотом,

трихлоруксусной кислотой и подофиллин. J Am Acad

Dermatol 1992; 26: 7104.

7. Бутби Р.А., Карлсон Дж. А., Рубин М., Морган М.,

Микута Дж. Дж. Однократное лечение вируса папилломы человека hu-

шейки матки и

влагалища трихлоруксусной кислотой: рандомизированное испытание

.Obstet Gynecol 1990; 76: 278–80.

8. Нишио К.Э., Петри В., Нарахаши Э. Волосатая лей-

коплакия в полости рта (OHL): местное применение трихлоруксусной и гликолевой кислот

— результаты. Международная конференция по СПИДу, 1994 г.,


, 7–12; 10: 182.

9. Илиас Кантас, Димитриос Г. Балацурас, Маринос

Вафиадис, Мария Т. Apostolidou, Agathok-

les Pournaras, Vasilis Danielidis. Применение трихлоруксусной кислоты

в лечении острого отита ex-

.Европейский архив оториноларин-

гология 2007; 1: 9-14.

10. Хао Линь, Энг-Янь Хуан, Хун-Яу Чанг и

Чан-Чао Чанцзян. Терапевтический эффект

местного применения трихлоруксусной кислоты при

вагинальной интраэпителиальной неоплазии после эктомии Hyster-

. Японский журнал клинической онкологии

2005; 35: 651-4.

11. J. Drabowicz, et al. В: Синтезы

сульфонов, сульфоксидов и циклических сульфидов,

с.112-116, G. Capozzi et al., Ред., John Wiley &

Sons, Чичестер, Великобритания, 1994.

12. Бранемарк П.И., Экхольм Р. Повреждение тканей, вызванное

дезинфекцией ран. J bone Joint Surg 1967;

49: 48-62.

13. Лайнуивер В., Ховард Р., Суси Д. и др. Антимикробная токсичность Topi-

кал. Arch Surg 1985; 120:


14. Brodland DG, Cullimore KC, Roenigk RK, Gibson

LE. Глубина хемексфолиации, вызванной различными концентрациями

и методами применения

трихлоруксусной кислоты на модели свиньи.J

Dermatol Surg Oncol 1989; 15: 967–71.

Автор, ответственный за переписку:

Ахмед М. Аль-Аббаси

Ассистент профессора оториноларингологии

Медицинский колледж Басры

Басра, Ирак

Электронная почта: [email protected]

BP Peroxide Solution Объемы — Обзор характеристик продукта (SmPC)

Эта информация предназначена для специалистов в области здравоохранения

Раствор перекиси водорода 3% БП 10 об. Водный раствор перекиси водорода 35% 7.5% об. / Об. В качестве активного ингредиента. Полный список вспомогательных веществ см. В разделе 6.1. Решение. Прозрачный бесцветный раствор. 1. Как мягкое дезинфицирующее средство для мелких порезов, ран и кожных язв. В качестве полоскания или полоскания рта. Актуальные.

Рекомендуемая доза и схема дозирования

1. В качестве дезинфицирующего средства используйте по мере необходимости. Перевязать рану ватой, смоченной перекисью водорода 2. В качестве жидкости для полоскания рта или полоскания рта разбавьте одну часть перекиси на две части воды (напр.грамм. 5 мл перекиси и 10 мл воды). Полоскать рот в течение двух-трех минут. Это можно повторять до трех раз в день. В качестве дезинфицирующего средства этот продукт подходит для использования взрослыми, детьми и пожилыми людьми. В качестве полоскания или полоскания рта продукт подходит для использования взрослыми, детьми старше 12 лет и пожилыми людьми. Из-за риска проглатывания его следует использовать только детям младшего возраста по указанию врача. Повышенная чувствительность к любому из ингредиентов Не использовать в закрытых полостях тела или на хирургических ранах из-за риска выброса кислорода в кровоток, вызывающего газовую эмболию.Не использовать в качестве дезинфицирующего средства для хирургических инструментов (особенно эндоскопов) и в качестве клизмы. Только для наружного применения. Храните все лекарства в недоступном для детей месте. Не использовать в закрытых полостях тела или на хирургических ранах из-за риска попадания кислорода в кровоток, вызывающего газовую эмболию. Избегайте нормальной кожи. Продукт отбеливает ткань. По возможности следует избегать приема всех лекарств во время беременности и кормления грудью. Нет никаких доказательств безопасности использования этого продукта в таких условиях.Сообщалось о случаях газовой эмболии, иногда приводящей к остановке сердца, когда перекись водорода закапывалась в закрытые полости тела или глубокие хирургические раны. Сильные растворы перекиси водорода вызывают раздражающие ожоги на коже и слизистых оболочках с белым струпом. Боль исчезает примерно через 1 час. Продолжительное использование продукта в качестве жидкости для полоскания рта может вызвать обратимую гипертрофию сосочков языка.

Сообщение о предполагаемых побочных реакциях

Сообщать о предполагаемых побочных реакциях после получения разрешения на лекарственный препарат очень важно.Это позволяет непрерывно контролировать соотношение польза / риск лекарственного средства. Медицинских работников просят сообщать о любых предполагаемых побочных реакциях через схему желтых карточек по адресу: www.mhra.gov.uk/yellowcard. Случайное проглатывание может вызвать боль в горле, желудочные расстройства и рвоту. Внезапное выделение кислорода может вызвать травму в результате острого вздутия желудка и внутреннего кровотечения. Воду можно напоить. Проглатывание больших объемов может привести к газовой эмболии вследствие выделения кислорода в желудке.A01A B02 — Противоинфекционные и антисептические средства для местного ухода за полостью рта. Перекись водорода используется как дезинфицирующее средство и дезодорант. При нанесении на ткани он выделяет кислород, эффект длится только до тех пор, пока выделяется кислород, и длится непродолжительно. Антимикробный эффект выделяемого кислорода снижается в присутствии органических веществ. Используется для очищения ран и язв в концентрации до 6%. Прилипшие и пропитанные кровью повязки можно удалить, нанеся раствор перекиси водорода.1,5% раствор используется в качестве жидкости для полоскания рта при лечении острого стоматита и в качестве дезодоранта для полоскания горла. Дополнительная информация недоступна. Нет релевантных данных, помимо тех, которые уже включены в другие разделы SPC. Концентрированная фосфорная кислота, фенацетин, очищенная вода. Несовместим с восстановителями, включая органические вещества и окисляющиеся вещества, а также со щелочами, йодидами, перманганатами и другими более сильными окислителями. Его разложение усиливается солями металлов, светом, возбуждением, теплом и металлами.

24 месяца без открытия.

Использовать в течение 28 дней с момента первого открытия

Не хранить при температуре выше 25 ° C. Хранить в оригинальной упаковке. 200 мл: Круглая бутылка из янтарного стекла с белой крышкой 28 мм с лентой для контроля вскрытия и вкладышем EPE Saranex. Thornton & Ross LimitedLinthwaite LaboratoriesHuddersfieldHD7 5QH

Винсент Стоматит — обзор

Некротические заболевания пародонта уникальны по своей клинической картине и течению. Данные свидетельствуют о том, что этиология и патогенез некротических заболеваний пародонта также могут отличаться от других заболеваний пародонта.Некротический язвенный гингивит (НЯГ) — это тип некротического заболевания пародонта, при котором некроз ограничивается тканями десны, а некротический язвенный пародонтит (НЯП) включает потерю клинического прикрепления и поражение альвеолярной кости.

Язвенно-некротический гингивит

Язвенно-некротический гингивит имеет острую клиническую картину с отличительными характеристиками: быстрое начало боли в деснах, межзубный некроз десен, обычно называемый «перфорированными» сосочками, и кровотечение (рис. 11-9).Язвенный и некротический сосочек и маргинальная десна могут быть покрыты желтовато-белым или сероватым слоем или псевдомембраной. Боль, часто интенсивная и внезапно возникающая, является важным диагностическим признаком, поскольку она редко встречается при гингивите и хроническом пародонтите, вызванном бляшками. Это состояние также известно как болезнь Винсента, траншейный рот и острый язвенно-некротический гингивит. 47 Начало NUG было связано с ранее существовавшим гингивитом, травмой тканей, повышенным психологическим стрессом, подавлением иммунитета, курением табака и недоеданием.В частности, острый психологический стресс, по-видимому, является предрасполагающим фактором и может способствовать неправильному питанию, участившемуся курению и плохой гигиене полости рта. Другие признаки и симптомы в более тяжелых случаях могут включать зловонный запах изо рта, лихорадку, лимфаденопатию и общее недомогание. Потеря прикрепления и кости редки при NUG, но могут быть связаны с множественными эпизодами с течением времени или NUG может накладываться на существующий пародонтит.

NUG — это инфекционное заболевание, наиболее связанное с веретенообразной бактериальной флорой спирохет.Были описаны четыре зоны с поражением десен:


Бактериальная зона: большая масса бактерий различных морфотипов


Зона, богатая нейтрофилами: лейкоциты с нейтрофилами и множеством спирохет между клетками


Зона некроза: распадающиеся клетки и множество спирохет и веретенообразных бактерий


Зона спирохетальной инфильтрации: тканевые элементы хорошо сохранены, но с инфильтрирующими спирохетами, кокками и палочками в смежных некротических соединительных областях 48

Микробиологические исследования продемонстрировали наличие анаэробной микрофлоры, состоящей из видов Treponema и Selenomonas , Fusobacterium nucleatum, Prevotella intermedia, и Porphyromonas gingivalis.NUG не считается передаваемым. 49

Иммуносупрессия может привести к угнетению функции нейтрофилов, включая хемотаксис, фагоцитарную активность и бактерицидные способности. Кроме того, в NUG также сообщалось об изменении функции лимфоцитов и отсутствии защитных антител. 50

Лечение консервативное, включая удаление зубного камня, антимикробные полоскания и, возможно, системные антибиотики. Также необходимо устранить первопричины, такие как стресс и недоедание.Признаки и симптомы NUG обычно исчезают быстро после лечения, часто в течение недели адекватной терапии, а дефекты мягких тканей обычно восстанавливаются при надлежащем домашнем и профессиональном уходе.

Язвенно-некротический пародонтит

Язвенно-некротический пародонтит (НЯП) определяется как тяжелое и быстро прогрессирующее заболевание, которое имеет характерную эритему свободной десны, прикрепленной десны и слизистой оболочки альвеол; обширный некроз мягких тканей; и серьезная потеря пародонтального прикрепления, но формирование глубоких карманов не очевидно (рис. 11-10). 51 Распространенность и демографические данные NUP среди системно здорового населения неясны. Клиническое мнение предполагает, что NUP является естественным, но не необходимым, прогрессированием нелеченого NUG. NUP может иметь социальные и клинические демографические, микробиологические и иммунологические характеристики, которые отличаются от NUG и предрасполагают субъектов к более прогрессирующему деструктивному заболеванию. 52

Данные свидетельствуют о том, что иммуносупрессия играет роль в риске НУП.В ВИЧ-инфицированной популяции с NUP у пациентов более чем в 20 раз больше шансов иметь количество CD4 + менее 200 клеток / мм 3 . Однако у большинства ВИЧ-инфицированных людей с числом клеток CD4 + ниже 200 клеток / мм 3 нет NUP, что позволяет предположить, что в этиологию и патогенез NUP вовлечены другие факторы. 53 Данные свидетельствуют о том, что состояние с ослабленным иммунитетом может изменять скорость прогрессирования заболевания, но первоначальная клиническая картина заболевания может зависеть от его микробной этиологии.

Добавить комментарий

Ваш адрес email не будет опубликован.