От стоматита синька как называется: Метиленовый синий – эффективное лекарство при стоматите у детей и взрослых — Genel

Содержание

✅ как называется синька для лечения стоматита

Тэги: язвенный колит у собаки симптомы и лечение, заказать как называется синька для лечения стоматита, гастрит у собаки симптомы лечение форум.


колит у ребенка симптомы и лечение комаровский, панкреатит капельницы лечение, гастрит без признаков атрофии слизистой лечение, афтозный стоматит лечение у взрослых фото, лечение гастрита язвы медом

Описание

Позаботиться о своем здоровье и о здоровье близких нужно уже сегодня. Ведь завтра может быть поздно! Пихтовый вар СИЛА ТАЙГИ - это биологически активное вещество из пихты, изготавливаемое по старинному рецепту вдалеке от городов в экологически чистом регионе (предгорье Саян в Сибири) методом экстрагирования из молодых побегов пихты сибирской, с исключительными свойствами. Внешне это вещество темно-коричневого цвета, имеющее густую однородную консистенцию и характерный неповторимый хвойный аромат. Если не лечить заболевание, то оно может обернуться более серьезными осложнениями. Надо это помнить всегда! Я в своей практике всегда сочетаю лечение средствами с натуральными компонентами. Именно поэтому я обратил внимание на пихтовый вар. Клинические испытания показали, что он действительно помогает бороться с самым широким кругом заболеваний и делает организм более крепким.


Официальный сайт как называется синька для лечения стоматита

Состав

Как лечит синька от стоматита, как правильно пользоваться для лечения детей, сколько стоит метиленовая синька, поможет ли вообще это средство против стоматита, читайте в нашей статье. Синька от стоматита – способы и особенности применения лекарства для детей и взрослых. При лечении различных типов стоматита у больших и маленьких пациентов профессионалы часто назначают метиленовый синий, или просто синьку. Это средство применяют несколько десятков лет. Правила применения синьки для лечения стоматита: показания и технология приготовления раствора. Синька или раствор метиленового синего – антисептик наружного применения. Используется для лечения грибкового, бактериального, а также герпетического стоматита. Показан для применения лицам. Лечение стоматита синькой у детей несколько отличается. В первую очередь важно отметить различие в применении, поскольку ребенок не. Для лечения грудничков синька от стоматита наносится на соски кормящей мамы. Так поступают, чтобы не травмировать нежную слизистую младенца бинтом, тампоном. Стоматит довольно распространённое заболевание, которое поражает слизистую оболочку рта. При этом заболевании появляется нежелательный дискомфорт и различные болевые ощущения при приёме пищи. Проверенным препаратом для лечения является метиленовый синий. Его применение при стоматите ускоряет выздоровление. Синька (в науке называется метиленовый синий) является лекарственным средством, которое. Эффективный и безопасный антисептик Метиленовый синий для лечения стоматита у детей и взрослых. Стоматит – распространенное заболевание слизистой ротовой полости, встречающееся у детей и взрослых.

Использование метиленовой синьки при лечении стоматита. Особенности применения для маленьких пациентов. Но это не лечение стоматита, а общие меры безопасности для организма. А вот для лечения назначается синька от стоматита. Инструкция к которой указывает, что взрослый пациент. Лечение стоматита синькой у детей несколько отличается. В первую очередь важно отметить различие в применении, поскольку ребенок не нуждается в таком количестве компонента. Инструкция по применению синьки от стоматита содержит отдельные правила для детского использования. Протирать ротовую. Водный раствор метиленового синего, который больше известен под названием синька, часто применяется для лечения стоматита. Препарат относится к группе антисептических средств, используемых для местного наружного применения. Благодаря отсутствию в сос. Синька, используемая для лечения стоматита, выпускается в качестве водного раствора. Если приобрести или использовать синьку для лечения стоматита не предоставляется возможным, то можно узнать у врача альтернативные препараты.
Аналогами Синьки выступают такие лекарства: Янтарная кислота. Синька при стоматите во рту. Синька - простонародное обозначение тиазинового красителя метиленового синего. возможны проявления аллергии в виде сыпи, покраснения, жжения и зуда; не рекомендуется использовать для лечения детей без предварительной консультации с врачом; короткий срок хранения; не. Лечение стоматита синькой проводим от 3 до 10 раз в день до полного исчезновения язв, ранок, эрозий. После применения лекарственного средства необходимо воздержаться в течение часа от приема пищи. Лечение стоматита синькой Как безопасно и эффективно использовать метиленовую синь при стоматите? Болезни ротовой полости очень часто встречаются у современного человека и одной из самых распространенных из них является стоматит. При наличии болезни Синька против стоматита. Перед назначением лечения стоматита, врач на приёме должен осмотреть поражённую. Для лечения, ограниченного нейродермита (заболевание, при котором у пациента наблюдается хронический зудящий дерматоз), назначают медицинскую синьку в качестве инъекций.

Результаты испытаний

У меня начался гастрит. Я люблю кушать гамбургеры, пиццу и всякое такое. Вот и допустила до болезни. Случайно нашла на этом сайте Пихтовый вар Сила Тайги. Понравилось мне, что состав полностью из травок. Заказ приехал очень быстро, и я сразу начала лечение. Где-то за месяц применения почувствовала облегчение. Желудок, поджелудочная в порядке. Всем рекомендую. Выделяется натуральный состав вара, богатый натрием, магнием, цинком, фосфором, калием, кальцием. Рецептура состоит из 100% водного экстракта сибирской пихты. Отсутствуют химические компоненты и искусственно выращенные элементы. Особенность Силы тайги — возобновляет недостаток нужных веществ, не влияет на полезную микрофлору. Свободные радикалы, аллергены и токсины выводятся, тело очищается от шлаков. Покров улучшается (цвет становится здоровым, тон – ровным). Усиливается моторная функция кишечника, обеспечивается питание на клеточном уровне.

Мнение специалиста

Вытяжку из пихты использовали с давних времен. Первые упоминания встречаются в славянских летописях Древней руси. Пихта, которую часто называют лесным доктором, дает людям здоровье и молодость. Пихтовый вар вырабатывается из молодой весенней хвои сибирской пихты. Самое эффективное средство для восстановления здоровья, заживления ран и очищения организма.

Самые опасные причины диареи без рвоты и температуры – это болезни и инфекции. Затем необходимо узнать точный диагноз и провести лечение. В случае некоторых вирусов и болезней делать это следует только в стационаре. Понос без температуры у взрослых встречается значительно чаще, чем у детей, однако это не исключает кишечный. Если на фоне диарее и рвоты у взрослого, наблюдается редкое мочеиспускание, производится срочная госпитализация. Для восполнения утраченной жидкости и электролитов назначают. Рвота и понос у взрослого без температуры. Причины Лечение. Что это такое, причины рвоты и поноса без температуры у взрослого человека, каковы симптомы и признаки диареи и рвоты, как лечить и что делать, какие лекарства принимать, какой диете следовать. Симптомы рвота и понос подходят. 3 Лечение. Причины рвоты и поноса у взрослого. И диарея, и рвотные реакции относятся к весьма неприятным состояниям. Диарея и рвота – это естественные органические реакции, направленные на очищение от токсических веществ. Если же остановить эти реакции, то токсины проникнут в кровоток, что. Рвотный рефлекс — это сложное состояние, в котором принимает участие большое количество мышц из разных групп. Регуляция рефлексом осуществляется в головном мозге. Лечение причины и последствий рвоты и поноса. Когда рвота и понос без температуры главное устранить причину. Простая питьевая вода не имеет сахара, минералов, а их теряет организм при диарее, важно восстановить эту потерю. Причины и лечение тошноты, рвоты с диареей без температуры. Когда у взрослого появляется рвота, тошнота, а также приступы поноса – это свидетельствует о пищевом отравлении либо о заболевании пищеварительной системы. Следует лечить не симптомы, а выявить заболевание. 2 Причины рвоты и поноса без повышенной температуры.

3 Сопутствующие симптомы. 4 Первая помощь. 5 Методы диагностики. 6 Медикаментозное лечение. 7 Что можно есть и пить при диарее и рвоте. Оглавление. Какие заболевания могут быть при тошноте и поносе без температуры. Симптомы и Причины. Лечение. Медикаментозное. Народные средства. Питание. Профилактика. Лечение поноса без температуры. После установления причины жидкого стула встает вопрос - как лечить понос?. К лечению хронической диареи необходимо подходить тщательно и обязательно начать его с посещения врача.

Способ применения

У меня начался гастрит. Я люблю кушать гамбургеры, пиццу и всякое такое. Вот и допустила до болезни. Случайно нашла на этом сайте Пихтовый вар Сила Тайги. Понравилось мне, что состав полностью из травок. Заказ приехал очень быстро, и я сразу начала лечение. Где-то за месяц применения почувствовала облегчение. Желудок, поджелудочная в порядке. Всем рекомендую.

И изжоги нет. Потом смотрите, с рациона еды удалите чай пакетированный. Изжогу победить нельзя, тем у кого не плотно закрывается, кардия Как избавиться от изжоги? Пять лет пью омепрозол, пока пью нормально, но стоит не выпить опять эта изжога.Чем вылечить? Подскажите. изжога чаще всего возникает от жирного, жареного и мучного. Пиццу любим на выходных откушать? Вообще очень полезно кисломолочные продукты употреблять (не Активию, а обычный кефир подойдет или йогурт) Если каждый. Лечение изжоги народными методами - Проверенные народные методы лечения изжоги. Отзыв рекомендуют:3636. Достоинства: Эффективно и дёшево. Пройдено куча врачей, обследований и лечения. Есть проблемы с ЖКТ гастрит, ГЭРБ. Вчера выпила 3 пакета в день и вечером накатила изжога, жуткая кис. в пищевод, что провоцировало жутчайшую изжогу, назначили курс лечения. ренни, изжогу на время снимает. Попейте лучше регулярно пока альмагель, он есть обычный, а есть с анастезином, при боли, тоесть он не только лечит, но. средство от изжоги нужно носит с собой и есть таблетка за таблеткой. Он это ренни пачками глотает, что для меня вообще страшно.

изжога-симптом заболевания ЖКТ и если она беспокоит часто-надо обследоватся и лечить.Лично я вылечила изжогу и гастрит диетой и на тощак выпивая белок. Несколько лет мучает меня изжога. Сначала повторялась нечасто, дальше больше бывает, что мучает после каждого приема пищи даже после легкого завтрака в виде овсяной каши, бутера с сыром и зеленым чаем. Страраюсь питаться.

Как заказать?

Заполните форму для консультации и заказа как называется синька для лечения стоматита. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении.

как называется синька для лечения стоматита. обострение панкреатита симптомы и лечение. Отзывы, инструкция по применению, состав и свойства.


Официальный сайт как называется синька для лечения стоматита

✔ Купить-как называется синька для лечения стоматита можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина Армения


Позаботиться о своем здоровье и о здоровье близких нужно уже сегодня. Ведь завтра может быть поздно! Пихтовый вар СИЛА ТАЙГИ - это биологически активное вещество из пихты, изготавливаемое по старинному рецепту вдалеке от городов в экологически чистом регионе (предгорье Саян в Сибири) методом экстрагирования из молодых побегов пихты сибирской, с исключительными свойствами. Внешне это вещество темно-коричневого цвета, имеющее густую однородную консистенцию и характерный неповторимый хвойный аромат.

Высокое содержание биологически активных веществ экстракта пихтового, легко устраняет витаминозный голод организма. Экстракт пихтовый, оказывает регенерирующее, антимикробное воздействие на организм. Не влияет на полезную микрофлору и поддерживает баланс минеральных веществ в организме. Нормализует обмен веществ. Подавляет воспаление, снимает симптомы интоксикации и диспепсии. Связывает и выводит аллергены, токсины, свободные радикалы. Является гипатопротектором, усиливает моторную функцию кишечника. Способствуют обогащению и питанию клетки, сокращая витаминное голодание организма.

Из-за грязного воздуха, плохой экологии, неправильного питания, вредных продуктов, разрушительного действия токсинов, лишнего веса, стресса и хронической усталости, в России ежегодно заболевают десятки миллионов взрослых и детей. Человек становится бессилен перед этими вредными факторами. Как же уберечь, защитить и оздоровить организм? Как найти путь и вернуть крепкое, ведь не зря говорят сибирское здоровье? Ответ очень простой. Пользоватся тем, что дала нам природа, что использовали наши предки, которые никогда не ходили по врачам, не ели таблеток и жили намного дольше чем живут люди сейчас.

Стоматит: лекарства, используемые при лечении

Стоматит — это название объединяет заболевания слизистой оболочки полости рта различного происхождения и проявления. 

Общие сведения

Стоматит может быть как самостоятельным заболеванием, так и осложнением или проявлением других, таких как: скарлатина, грипп, корь и пр. Наиболее подвержены заболеванию дети.

Заболевания слизистой оболочки полости рта встречаются достаточно часто, но при этом их правильная диагностика бывает затруднена. Это связано с тем, что различные заболевания не только ротовой полости, но и всего организма, могут протекать с одинаковыми проявлениями. Заболевания слизистой оболочки рта объединяются под общим названием - стоматиты. Если же поражается слизистая оболочка не всей полости рта, а только отдельного участка - языка, губы или неба, то говорят о глоссите, хейлите или палатините соответственно.

Причины возникновения стоматита

Причиной возникновения стоматитов могут являться различные факторы - те, которые воздействуют непосредственно на слизистую оболочку рта (местное воздействие), а также заболевания организма - болезни желудочно-кишечного тракта, сердечно-сосудистой системы, ослабление иммунной защиты, аллергические реакции, нарушения обмена веществ и многие другие.

Местная связана с участием непосредственного фактора травма, химическое, термическое, лучевое воздействие, в результате которого на слизистой оболочке возникают покраснения, эрозия, язва.

Отдельного разговора заслуживают стоматиты, возникающие при стоматологических проблемах. В этом случае причиной является несоблюдение пациентом гигиены полости рта, обильные зубные отложения, разрушенные зубы, дисбактериоз полости рта. Кроме того, стоматиты могут возникать при нарушениях в технике стоматологических манипуляций. Их причиной становятся микротравмы, использование разнородных металлов при лечении и протезировании, воздействие химических веществ.

Симптомы стоматита

По клиническому проявлению стоматиты разделяются на:

  • катаральные;
  • язвенные;
  • афтозные.

Что такое катаральный стоматит

Kатаральный стоматит - наиболее часто встречающееся поражение слизистой оболочки полости рта. При этом слизистая оболочка рта становится отечной, болезненной, гиперемированной, она может быть покрыта белым или желтым налетом. Отмечается гиперсаливация (повышенное выделение слюны). Может отмечаться кровоточивость десен, появляться дурной запах из рта.

Что такое язвенный стоматит

Язвенный стоматит - более тяжелое заболевание, чем катаральный, он может развиваться как самостоятельно, так и быть запущенной формой катарального.

В отличие от катарального стоматита, поражающего только поверхностный слой слизистой оболочки, при язвенном стоматите поражается вся толща слизистой.

Начальные признаки при катаральном и язвенном стоматите похожи, однако впоследствии при язвенном стоматите отмечается повышение температуры до 37,5 С, слабость, головная боль, увеличение и болезненность лимфатических узлов. Прием пищи сопровождается сильными болевыми ощущениями. При появлении таких симптомов необходимо обратиться к врачу.

Что такое автозный стоматит

Афтозный стоматит - характеризуется появлением единичных или множественных афтознозных язв на слизистой оболочке полости рта, при которой язвы бывают большими и глубокими. Афты бывают овальной или округлой формы, с четкими границами в виде узкой красной каймы и серовато-желтым налетом в центре.

Заболевание начинается с общего недомогания, повышения температуры тела, появления болевых ощущений во рту на месте образования афт. Лечение такой язвы обычно довольно сложное, и после ее заживления остаются следы. Лечением этого заболевания должен заниматься врач.

При ослабленном иммунитете, возможно появление инфекционного стоматита, который вызывается различными микробами, обитающими на поверхности слизистой оболочки рта и находящимися в неактивном состоянии до тех пор, пока иммунитет не ослаблен.

Если вы однажды переболели стоматитом, вероятность повторения заболевания весьма велика, хотя частота этих повторений крайне изменчива. Если болезнь повторяется три-четыре раза в год - такую частоту можно назвать типичной. У некоторых людей, однако, стоматит может стать почти хроническим - язвы не успевают зажить, как появляются новые.

Как правило, впервые стоматитом болеют в возрасте от 10 до 20 лет, после чего по мере взросления он повторяется реже и с меньшей болезненностью.

Стоматитом болеют примерно 20% населения.

Нет никаких свидетельств того, что стоматит заразен.

Что можете сделать вы

Необходимо регулярно консультироваться со стоматологом для избежания возникновения стоматита, а в случае его возникновения соблюдать все рекомендации, данные стоматологом.

В процессе лечения стоматита не рекомендуется употребление острой, солёной или кислой пищи. Еда должна быть нейтральной по кислотности и не вызывать дополнительного раздражения слизистой оболочки рта, а также в ней должно быть достаточно витаминов для ускорения процесса лечения.

Если вы обнаружили у своего ребёнка симптомы стоматита, необходимо срочно обратиться за консультацией к лечащему врачу.

Что может сделать врач

Для эффективного лечения стоматита следует сначала установить причину его возникновения, что может быть сделано лишь под руководством врача.

Стоматолог при осмотре ротовой полости тщательно осмотрит поверхность всех зубов, выявит необходимость замены уже имеющихся пломб или обработки поврежденных зубов, подгонит зубные протезы.

Лечением афтозного стоматита занимается только врач.

В случае, когда приняты все меры по лечению стоматита, а стоматит все равно не проходит, нужно искать другую причину возникновения стоматита, вероятнее всего это какое общее заболевание организма, выявлением и лечением которого занимается только врач.

Профилактика стоматита

Поскольку травма тканей рта может вызвать образование стоматита, следует остерегаться повреждений такого рода. Сломанные зубы, грубые или поломанные пломбы, зубы с острыми краями - все это немедленно следует отдать "на растерзание" стоматологу. Следует обязательно подогнать и протезы с острыми или жесткими краями. Если установлены брекеты, то выступающие части и брекеты можно покрыть зубным воском. Чистить зубы щеткой и нитью нужно осторожно, но тщательно.

В качестве профилактики стоматита следует ежедневно чистить зубы. Особенно это касается беременных женщин и детей подросткового возраста.

Синька от стоматита - vvv-dent.

ru

Как применяется синька от стоматита (метиленовый синий)

Заболевания полости рта встречаются довольно часто. Если вы заметили, что на слизистой оболочке стали появляться маленькие язвочки, вы столкнулись со стоматитом – недугом, которому подвержено огромное количество людей. Болезнь потребуется лечить, иначе она может перерасти в более грозную форму.

Врачи на сегодня располагают достаточно внушительным арсеналом медикаментозных средств, они позволяют эффективно бороться с данным заболеванием. В частности, синька от стоматита очень действенное средство. Что это такое, мы поясним в данном материале.

Симптомы заболевания

Stoma – слово, имеющее греческие корни, оно обозначает «рот». Для стоматита характерны следующие симптомы:

Образование белого или желтого налета.

Повышение температуры, ее довольно сложно сбить медикаментозным лечением.

Неприятный запах изо рта.

Если стоматит отличается единичным проявлением, он, скорее всего, отступит сам – это займет примерно неделю. Однако, если у вас есть сомнения, лучше все-таки показаться лечащему врачу, особенно, если симптомы стоматита у ребенка.

Способы борьбы со стоматитом

Зачастую врачи прописывают больным синьку. Для многих людей при упоминании синего всплывает в памяти средство, которое во времена СССР включалось в краску белого цвета при белении потолка. Безусловно, речь не об этом. Под медицинской синькой понимается крахмал – он бывает синий (за что и получил свое название — синь), но может быть и йодистым. По применению это довольно сильное антисептическое средство, которое эффективно борется с различными патогенами в полости рта. Хотя стоматит лечится не одним данным средством, тем не менее, высокое нейтрализующее действие синьки на вредные микроорганизмы давно доказано.

Также, помимо этого средства, врач может прописать аппликации, их следует прикладывать к язвочкам в целях снятия болевых симптомов. Другим вариантом являются полоскание ротовой полости, лечение больного антибиотиками (последний случай свидетельствует о серьезном случае заболевания).

Применение медицинской синьки для взрослых

Поскольку часто поднимается температура при стоматите, врачи выписывают препараты, снижающие жар. Тем не менее, такие средства не лечат непосредственно заболевание, а, скорее, устраняют его вредоносное действие, повышая безопасность для всего организма. Метиленовый синий при стоматите направлен именно на лечение. Взрослый человек должен обрабатывать пораженные болезнью участки до 15 раз в течение дня. Обработка слизистой ведется водным раствором, концентрация его должна быть равна 1%. Ни в коем случае нельзя путать синьку со спиртовым метиленовым синим.

Если воздействие препарата на язвочки в полости рта многократно, то последние довольно быстро исчезают, однако это еще не говорит о полном выздоровлении. Взрослый человек нуждается в обработке слизистой и зубов специальными лекарствами, они способны внять раздражение и окончательно избавляют от вредоносных патогенов – скажем, льняное масло, облепиха и т. п.

Лечение синькой стоматита у детей

Использование метиленового синего для детей несколько отличается применения у взрослых лиц. Во-первых, детям нельзя столь часто обрабатывать язвочки. Максимальное количество применений в течение дня не должно превышать четырех, причем делается это строго после еды.

Если лечение стоматита проводится для грудничка, следует позаботиться и о маме, если последняя является кормящей. На ее соски также наносится несколько капель раствора – в этом случая малышам не требуется мазать слизистую ватными палочками или дисками (во избежание риска повреждения внутреннего пространства рта), но некоторое количество синьки все равно малыш получит.

Использование синьки в СССР

Одно из медицинских учреждений СССР в середине прошлого века проводило интересный эксперимент. Собрали детскую группу из 86 человек, причем возраст всех был различный – 1-10 лет. Объединяло детей лишь одно – все они страдали стоматитом в той или иной форме. Так, афтозным типом были заражены 56 детей, 17 человек столкнулись с аллергическим стоматитом, еще у 13 детей была язвенная форма.

Для всех пациентов было проведено полное медицинское обследование, обнаружены возбудители и т. п. Дети прошли курс лечения синькой, однако в различных формах.

Сначала выделили группу малышей, возраст которых не превышал 1,5 лет. Обработку пораженных участков вели йодистым крахмалом. Также была средняя группа, где были собраны детишки до 2 лет, в данном случае их лечили аппликациями. В обоих группах нанесение проводилось каждый день – сначала в стенах института, а после дома.

Вместе с этим была выделена группа, которая лечилась антибиотиками, прописанными врачами в поликлинике. Интересно, что при таком лечении полное избавление от болезни в полости рта наступало лишь через 9-10 суток.

Иначе говоря, эксперимент показал, что метиленовый синий при стоматите дает хорошие результаты (еще раз заметим, что речь идет о водном растворе, а не спиртовом). После этого синька была рекомендована для применения в детских медицинских учреждениях. Странно, что об этом средстве даже спустя столько лет слышали далеко не все, метиленовый синий непопулярен совершенно незаслуженно.

Практически все родители сегодня стремятся избавлять детей от заболевания модными кремами, спреями, таблетками, которые не столько эффективны, да и стоят в разы дороже. Так уж повелось, что сегодня эффективность лекарства напрямую связана с его ценой – якобы, чем дороже, тем лучше. К слову, синька изготавливается не в каждой аптеке, зато дорогие средства есть практически везде. Тем не менее, и по сей день метиленовая синька остается одним из наиболее эффективных препаратов для лечения стоматита. Она обладает противогрибковым действием, отлично борется с вирусной инфекцией, справляется с бактериями. Кроме того, синька обладает способностью заживления, снятия воспалений. Таким набором мощных воздействий может похвастаться сегодня далеко не каждый препарат.

Отличное средство — синька от стоматита

Стоматит — воспалительный процесс на слизистой эпителия ротовой полости. Его происхождение и проявления различны.

Он может выступать как самостоятельное заболевание, так и как осложнение. Этой болезни подвержены как младшая, так и старшая возрастные группы.

Причинами возникновения стоматита выступает множество факторов. Заболевание подразделяется на несколько типов, которые напрямую зависят от природы поражающего воздействия.

Синька при стоматите во рту

Синька — простонародное обозначение тиазинового красителя метиленового синего. Этот старый препарат обладает мощным антисептическим свойством.

Для врачебного применения это лекарство выпускают в виде 1% водного и 1% спиртового раствора и в порошке.

Этот медицинский препарат является безопасным средством, поэтому его используют как для нанесения на слизистые, так и принимают внутрь (только по рекомендации врача).

Из-за антисептических свойств, медики разрешают использовать это медицинское средство для устранения вредных микробов и бактерий во рту и для терапии от стоматита. При острой и хронической форме заболевания лекарство используется для обеззараживания всей слизистой полости рта (с помощью ватного круга). Основа действия препарата базируется на его возможности объединяться с белками бактериальных клеток, за счёт чего происходит нейтрализация опасных микробов.

Важно! Непосредственно перед началом лечения нужно убрать налёт с язв во рту с помощью ваты, обработанной натуральным маслом. Для обработки подойдут льняное, облепиховое, персиковое и шиповниковое масла.

Метиленовая синь, плюсы и минусы

Достоинства:

  • характеризуется высоким окислительно-восстановительным и антисептическим воздействием;
  • в составе нет спирта, что позволяет применять лекарство для лечения детей;
  • безопасность;
  • низкая стоимость;
  • процесс заживления язв начинается уже на 3 день;
  • применяется и единолично и в рамках комплексного воздействия;
  • препарат можно приготовить самостоятельно;
  • выводится природным путём;
  • средство разрешается использовать во время беременности.

Фото 1. Метиленовая синь от производителя Bluebrainboost качественно и безопасно помогает бороться со стоматитом как у детей, так и у взрослых.

Недостатки:

  • яркий синий цвет препарата, любые действия с синькой необходимо производить в перчатках, а обработанные слизистые на какое-то время приобретают ярко-синий цвет;
  • нельзя применять детям младшей возрастной группы — до года;
  • низкая эффективность против ряда определённых вирусов и бактерий;
  • возможны проявления аллергии в виде сыпи, покраснения, жжения и зуда;
  • не рекомендуется использовать для лечения детей без предварительной консультации с врачом;
  • короткий срок хранения;
  • не всегда есть в продаже.

Противопоказания и показания

Этот медицинский препарат противопоказан при индивидуальной непереносимости или аллергии. А также важно помнить что его запрещается применять для лечения возрастной группы, не достигшей 1-го года.

Справка! Средство в форме водного раствора трудно найти в продаже. Синьку можно заказать в отделе рецептов по предварительно выписанному рецепту врача, но срок использования будет иметь жёсткое временное ограничение.

При вскрытии промышленно изготовленного медицинского средства срок его хранения после вскрытия индивидуальной упаковки около 10 — 12 суток.

Этот лечебный раствор действенен только при форме заболевания, вызванной микробами (например, афтозная форма стоматита).

При герпетическом типе заболевания синька не оказывает лечебного воздействия, а только создаёт защиту для повреждённой слизистой рта от повторного инфицирования.

При этом раствор метиленового синего рекомендуется использовать только в качестве вспомогательного средства.

Справка! Результативность применения синьки становится выше при комплексном использовании с Холисалом или Йодинолом.

Рецепт и инструкция по применению

Разрешается использовать только 1% водный раствор метиленового синего. Спиртовой — не подходит, так как может спровоцировать ожоги рта, а также дискомфортные ощущения во рту и боль.

Инструкция: 1% раствор метиленового синего рекомендуется наносить конкретно на локальные места поражения (на пузыри и язвочки) на слизистой от 6-ти до 10-ти раз в сутки (допускается 15 раз в сутки). Наносить раствор рекомендуется после еды.

Терапевтические действия, направленные на лечение острой формы болезни с помощью синьки, длятся около недели, лечение хронической формы может занимать до 14 — 20 дней.

Лечение раствором у детей

Детские врачи достаточно редко назначают синьку, так как сейчас есть множество новых действенных средств для устранения разных форм болезни.

Если же по каким-либо причинам необходимо именно это средство, перед применением важно провести беседу с медицинским специалистом.

Синьку позволительно использовать в терапевтических мерах детям от 1 года, также она подходит для всех остальных возрастных групп.

Правила по применению для детей практически совпадает с правилами для взрослых. Раствор наносят на поражённые места на слизистой 4 раза в сутки после еды (для старшей возрастной группы) и не более 2-х раз детям до 6-ти лет.

Полная обработка слизистой полости рта этим медицинским средством выполняется только на ранней стадии лечения, в дальнейшем же во избежание раздражения необходимо перейти на точечную обработку язв.

Полезное видео

Со стоматитом можно бороться и в домашних условиях, посмотрите видео, в котором показаны способы лечения болезни.

Лучшее средство ребенку

Синька — безопасное, проверенное годами средство от стоматита для взрослых и детей. Несмотря на появление более быстродействующих медицинских препаратов для устранения клинических проявлений стоматита, лечение болезни синькой, в ряде случаев оказывается самым простым и эффективным.

Синька от стоматита

Метиленовый синий – эффективное лекарство при стоматите у детей и взрослых

Стоматит – распространенное заболевание слизистой ротовой полости, встречающееся у детей и взрослых. Заболевание сопровождается образованием язвенных поражений на слизистой рта: во рту образуются болезненные язвочки, мешающие есть и говорить.

Стоматит может появиться как у ребенка, так и у взрослого человека. Существуют различные причины возникновения стоматита, но главными являются отсутствие профилактики заболевания, а также несоблюдение правил гигиены ротовой полости.

Согласно статистике, от стоматита страдает более 20% населения, причем большая часть из них – дети.

Симптомы стоматита

  • Отек слизистой ротовой полости с появлением белого или желтоватого налета
  • Болезненные ощущения: боль, жжение, зуд или сухость слизистой полости рта
  • Неприятный и резкий запах изо рта, повышенное слюноотделение
  • Образование язв в ротовой полости (чаще всего язвы образуются на внутренней
    поверхности щек, губ и на миндалинах, реже – на языке и под языком)
  • Возможно повышение температуры тела и увеличение лимфатических узлов

Профилактика стоматита

Главная мера профилактики заболевания – регулярная гигиена полости рта. Не забывайте ежедневно чистить зубы и доступные слизистые оболочки (десны, внутренняя поверхность щек, язык).

Кроме того, регулярные посещения стоматолога помогут предупредить стоматит, ведь зубные отложения (зубной камень или налет), а также пораженные кариесом зубы также могут спровоцировать развитие стоматита. Травма тканей рта тоже может привести к развитию воспаления, поэтому важно вовремя обратиться к стоматологу при возникновении скола зуба или выпадении пломбы.

Важно помнить, что в большинстве случаев стоматит развивается на фоне ослабления иммунитета, поэтому необходимо избегать стрессов и вредных привычек, соблюдать режим дня и поддерживать сбалансированную диету.

Лечение стоматита Метиленовым синим

Метиленовый синий – безопасный и эффективный антисептический препарат. Он оказывает выраженное бактериостатическое и антисептическое действие. В медицинской практике данное средство зарекомендовало себя для борьбы со стоматитом и на протяжении многих лет пользуется доверием практикующих врачей и педиатров.

Важно применять не спиртовой, а водный раствор Метиленового синего (например, от компании Genel), так как спирт может привести к ожогу ротовой полости.

Важное преимущество Метиленового
синего производства компании Genel –
препарат не содержит спирта и не вызывает
побочных эффектов
, поэтому может
применяться для лечения стоматита
у взрослых и детей с самого рождения.

Лечение стоматита Метиленовым синим у детей проводится под контролем врача-педиатра. Взрослым же необходимо пройти обследование у стоматолога, который диагностирует этиологию воспалительного процесса и назначит комплексную терапию.

Как правильно применять Метиленовый синий для лечения стоматита?

Препарат успешно используется для обработки слизистой оболочки ротовой полости.

  • Лечение стоматита у детей, находящихся на грудном вскармливании, осуществляют методом обработки раствором метиленового синего сосков матери перед началом кормления. Такой способ минимизирует риск повреждения слизистой оболочки ротовой полости ребенка ватными дисками, бинтами и тампонами.
  • При афтозном (язвенном) стоматите обработку проводят при помощи ватной палочки, пропитанной водным раствором Метиленового синего. Язвочки на внутренних поверхностях полости рта пропитывают препаратом, предварительно промокнув слюну стерильным бинтом. Обработку производят после еды, детям и взрослым 2-3 раза в день.
  • При стоматите вирусного происхождения (стоматит, вызванный герпесом) для обработки слизистой ротовой полости и губ используют 1% водный раствор Метиленового синего. Гнойники и высыпания смазывают 2-3 раза в день после еды и полоскания полости рта. При вирусной инфекции Метиленовый синий назначается в составе комплексной терапии, поэтому важно принимать другие лекарства, назначенные врачом.

Важно помнить, что после обработки препаратом ротовой полости нельзя есть и пить как минумум в течение получаса. Также во время лечения стоматита не рекомендуется употребление горячей, кислой, острой или соленой пищи во избежание дополнительного раздражения слизистой оболочки полости рта.

При активном использовании Метиленового синего заживление язв происходит уже спустя 3-5 дней, а значительное облегчение наблюдается уже после первого использования средства.

В процессе лечения слизистые оболочки окрашиваются в синеватый цвет. Не стоит пугаться: Метиленовый синий нетоксичен и безопасен как для взрослых, так и для детей.

Меры предосторожности: при возникновении аллергических реакций необходимо прекратить применение препарата и обратиться к врачу.

Синька от стоматита у детей, как праивильно пользоваться

Заболевание в ротовой полости встречаются довольно часто в повседневной жизни, поэтому синька от стоматита пользуется большой популярностью. Самыми распространенными признаком заболевания являются язвы небольшого диаметра, доставляющие дискомфорт и болезненные ощущения. Однако вопрос о том, какие средства действительно помогают преодолеть стоматит максимально быстро, у специалистов и пациентов мнения сходятся. В простонародье оно называется «Синька».

Симптоматика заболевания

Название заболевания произошло от греческого слова, обозначающего рот. Самыми распространенными проявлениями считаются:

  1. Деформация слизистой в ротовой полости, появление отечности.
  2. После образования белесого налета, появляются язвы небольшой формы.
  3. Стремительное повышение температуры, которая не поддается медикаментозному воздействию.
  4. Десна теряет свою упругость и начинают кровоточить.
  5. Наличие специфического неприятного запаха в процессе развития воспалительного процесса.

Синька при стоматите у детей активно используется со времен 90-х годов, поэтому в сегодняшнее время, она находит широкое применение. Однако если ребенок совсем маленького возраста и заразился стоматитом, то лучше сначала проконсультироваться со специалистом.

Синька от стоматита

Метиленовая синь при стоматите у ребенка используется в качестве эффективного антисептического вещества.

Хотя сегодня медицина далеко ушла вперед и представляет практически каждый день новое чудодейственное лекарство, синька остается самым эффективным средством.

Стоит отметить, что методика лечения напрямую зависит от того, какую форму заболевания успел заполучить ребенок. Например, если язвочки уже начали появляться на внутренней стороне щек или по всему рту, рекомендуется выбирать противовоспалительные средства, противовирусные и различные полоскания.

Особенности лекарства и специфика применения

Метиленовый синий от стоматита активно используется для лечения воспалительных процессов, локализованных в ротовой полости. Вступая в реакцию с вирусом, начинает выделяться специальный белок. Однако результат данной реакции приводит к стремительной гибели микроорганизмов и человек начинает чувствовать себя намного лучше. Синька не способна адсорбировать, поэтому не происходит ее накопление в крови. Поэтому ее можно использовать даже беременным женщинам или грудничкам. Помогает в регенерации поражённых участков. При правильном и частом применении, синька создают пленку на поверхности язв, таким образом, постепенно затягивая их.

Метиленовый синий при стоматите у детей также используется без риска для здоровья, поскольку лекарство не попадает в кровоток и не отравляется организм вредными веществами. Самое важное, что препарат не оказывает негативного воздействия на печень и другие органы выделительной системы.

Применение для детей и взрослых

Как правило, вне зависимости от возраста пациента, у него повышается температура, поэтому приходится использовать жаропонижающие средства. Однако, это общие требования, которые необходимы для поддержания организма. Их выполнение никаким образом не сказывается на состоянии человека или эффективной борьбы со стоматитом. Метиленовая синька при стоматите – это отличное средство, которое поможет вернуть здоровье ротовой полости. Однако использовать ее необходимо с умом.

В первую очередь важно ознакомиться с дозировкой, чтобы не сжечь и не навредить ротовой полости. Для детей и взрослых она различна. Например, для взрослого человека рекомендуется использовать синьку в течение дня не менее 15 раз. Предварительно важно сделать 1% водный раствор. Использовать лекарство лучше всего с помощью обыкновенной ватной палочки. Предварительно при помощи стерильного и гигиеничного материала необходимо промокнуть слюну. Как правило, если соблюдены все условия, то взрослый человек довольно быстро забывает, что такое стоматит. Однако врачи рекомендуют после того, как все язвы будут вылечены, на протяжении некоторого времени использовать заживляющие мази или гели.

Лечение стоматита синькой у детей несколько отличается. В первую очередь важно отметить различие в применении, поскольку ребенок не нуждается в таком количестве компонента. Инструкция по применению синьки от стоматита содержит отдельные правила для детского использования.

Протирать ротовую полость ребенка 1% исключительно водным раствором можно не чаще 4-х раз в день и желательно делать это после приема пищи. Важно отметить, что причины, которые вызвали стоматит, также влияют на тактику лечения. Например, если главным провокатором является герпес, то можно увеличить количество обработки синькой до 5 раз.

Техника обработки

Чтобы помочь грудничкам поскорее избавиться от болезненных ощущений, иногда синька наносится на соски матери, после чего малыша прикладывают к груди. Что касается содержания компонента в растворе, для каждого детского возраста имеются свои показатели, которые назначает только детский терапевт.

Использовать препарат довольно просто. Для этого необходимо следовать следующим рекомендациям:

  1. Предварительно удаляем белый налет во всей ротовой полости.
  2. Берем ватный диск, смачиваем маслом из натурального экстракта, а затем опускает в раствор синьки.
  3. Аккуратно обработать ротовую полость.

Крайне важно не забывать проводить процедуры каждый день, чтобы устранить воспалительный процесс и активно воздействовать на возбудителя инфекции.

Отвечая на вопрос, где купить синьку от стоматита, можно обратиться абсолютно в любую аптеку, поскольку препарат имеет большой спрос среди населения и для его приобретения не понадобиться рецепт. Средняя цена препарата — 32 рубля.

Побочные симптомы

К сожалению, даже самое безопасное лекарство не может гарантировать 100% отсутствие побочных симптомов. В первую очередь важно отметить, что риск безопасности возникает в тот момент, когда происходит обработка сильно пораженных участков. В результате, ребенок может почувствовать сильное жжение либо покраснение.

Как правило, подобная симптоматики возникает только в двух возможных случаях:

  1. Индивидуальная непереносимость, ввиду специфического реагирования организма.
  2. Несоблюдение дозировки.

Также в процессе множественных исследований было отмечено, что синька может вызывать расстройство пищеварительной системы, если пациент страдает серьезно пониженным иммунитетом. В таком случае специалист может добавить препараты, способствующие восстановлению микрофлоры. Других побочных симптомов не было замечено ни у одной группы испытуемых, что может говорить о полной безопасности препарата.

Медицинские исследования

В середине XX века на территории РФ началась пара массовых экспериментов. В качестве испытуемых выбирались дети в возрастном диапазоне 1,5 – 10 лет. Всего было отобрано 86 желающих. Группа была подобрана таким образом, чтобы присутствовали различные формы болезни. Таким образом, и 86 человек, 56 имели явные признаки появления афт, в 17 случаях стоматит проявлялся как ответная аллергическая реакция на медикаментозный препарат, 13 страдали язвенными высыпаниями. Все выводы были проверены качественным медицинским обследованием, поэтому вероятность ошибки существовала минимальная.

Во время эксперимента при использовании синьки, были получены следующие результаты:

  • В течение трех дней у детей начинала падать температура;
  • По истечению недели, организм ребенка начинал активно бороться и наступала стадия выздоровления.

Учитывая эти данные можно сделать вывод, что синька — это эффективное средство для лечения стоматита у детей, с минимальными, или полным отсутствием побочных эффектов и достаточно хорошим результатом.

Метиленовый синий: инструкция по применению для детей при стоматите – как правильно применять раствор синьки

Синька или раствор метиленового синего – антисептик наружного применения. Используется для лечения грибкового, бактериального, а также герпетического стоматита. Показан для применения лицам старше года. При регулярном применении позволяет добиться стойкого терапевтического эффекта за 3-5 дней. В этом материале мы разберемся, что такое синька, каковы активные компоненты этого средства, их свойства, показания и противопоказания к применению препарата, особенности его использования в различных возрастных группах, возможные побочные эффекты, а также аналоги, представленные на рынке.

Состав и форма выпуска препарата – синька или метиленовый синий раствор

Метиленовый синий раствор (по-другому называется синька) – антисептический раствор, основным действующим компонентом которого является метилтиониния хлорид, вспомогательным компонентом представленного средства является дистиллированная вода. Выпускается он во флаконах емкостью 25 мг.

Раствор представляет собой однородную жидкость синего цвета без осадков. Также в продаже представлена синька в виде порошка для домашнего приготовления раствора, а также раствор синьки на спирту. Препарат отпускается без рецепта.

Для обработки слизистой рта надо использовать водный раствор синьки. Он не раздражает слизистую и подходит даже для детей от года. Жидкость на спиртовой основе может привести к возникновению ожогов на слизистой.

Свойства и применение в медицинских целях

Данный препарат относится к группе антисептиков, назначаемых для наружного применения (действие аналогично Мирамистину или Хлоргексидину от стоматита). Его активное вещество связывает бактериальные клетки, останавливает развитие патогенных организмов. Дополнительно это средство создает на поверхности слизистой защитную пленку, способствующую ускоренной регенерации тканей. Препарат эффективен против большинства патогенных бактерий и при систематическом использовании позволяет лечить такую болезнь, как стоматит, за 5 дней.

Активные компоненты представленного препарата не проникают в кожный кровоток. Это исключает возможность какого-либо токсического воздействия препарата на организм.

Инструкция: показания и противопоказания

Раствор метиленового синего могут назначить при герпетическом, бактериальном либо же грибковом стоматите. Препарат может быть назначен как для лечения острой формы заболевания, так и для купирования хронического воспалительного процесса.

Противопоказаниями к использованию препарата для лечения стоматита являются:

  • повышенная чувствительность к препарату;
  • беременность, кормление грудью;
  • возраст пациента до года.

Ели пациент не знает точно, есть ли у него аллергия на синьку или нет, ему рекомендуется перед применением такого препарата проконсультироваться с врачом. По необходимости медик сделает ему аллергопробу. Если она покажет, что к препарату имеется повышенная чувствительность, его заменят на другое, более безопасное для конкретного пациента средство, например Мирамистин или Хлорофиллипт. Подробней о применении Хлорофиллипта от стоматита читайте в этой статье.

Как пользоваться и правильно разводить жидкость при стоматите

Для лечения стоматита может применяться водный раствор синьки или же порошок для приготовления водного раствора. Препарат наносят непосредственно на пораженные участки посредством ватного тампона или же ватной палочки. Для усиления эффективности препарата при лечении афтозного стоматита очаги поражения рекомендуется обработать маслом шиповника или персика. Эти средства хорошо снимают с язв налет, чем усиливают действие антисептика. В качестве альтернативы можно использовать и облепиховое масло. Подробности о том, помогает ли облепиховое масло от стоматита смотрите далее.

Срок лечения препаратом составляет от 5 до 10-ти дней, зависит от типа стоматита и общего состояния больного. При правильном применении средства улучшение состояния больного отмечается уже на третьи сутки.

В первые дни лечения заболевания при остром течении стоматита рекомендуется обрабатывать всю ротовую полость. Это позволит остановить развитие инфекции и облегчить состояние больного.

Лечение болезни у взрослых

Пациентам старше 18-ти лет при стоматите рекомендуется использовать раствор метиленового синего только для обработки повреждённых участков слизистой. Работать с этим препаратом им следует так:

  1. Для начала нужно прополоскать рот отваром лекарственных трав, к примеру, ромашки или дуба, чтобы снять налет с афт.
  2. Далее следует промокнуть слизистую, чтобы убрать с нее оставшуюся влагу.
  3. На чистый сухой ватный тампон надо набрать синьку. Обработать ей пораженные участки слизистой, а также близлежащие ткани.

Процедуру нужно повторять не менее 3-х раз в день. Срок лечения средством устанавливает врач.

В течение получаса после применения синьки пациенту нельзя есть и пить. Нарушение этого правила может негативно сказаться на эффективности лечения.

Лекарство детям

Рекомендации по применению синьки для детей зависят от возраста малышей:

  1. Пациентам от года синьку рекомендуется наносить на соску. Это позволяет избежать травм слизистой.
  2. Детям до 3-х лет рекомендуется наносить раствор на пораженные участки слизистой. Манипуляцию нужно повторять 3-4 раза в день.
  3. Детям старше 6-ти лет можно давать синьку в качестве раствора для полоскания.

Детям любого возраста давать синьку нужно строго после кормления. Также нужно следить за тем, чтобы ребенок после обработки полости ничего не брал в рот. В противном случае он может занести инфекцию. Если это случится, вам нужно будет обратиться к стоматологу для повторного обследования и подбора нового лекарства.

Приготовление и правила использования раствора для полоскания

Для полоскания ротовой полости готовят раствор синьки в соотношении 1:5000. Для приготовления препарата для полоскания берут водный раствор синьки. Полоскания проводят после приёма пищи.

Повторяют данную процедуру 3 раза в день при обычном стоматите. Если у человека отмечен герпетический стоматит, количество полосканий может быть увеличено до 5-ти раз в день. Больше информации о том, чем полоскать рот при стоматите читайте тут.

Следует помнить о том, что синька является красящим веществом. Работать с ней рекомендуется только в перчатках, чтобы не окрасить кожу.

Побочные эффекты

При превышении рекомендованной дозы препарата или повышенной чувствительности человека к активному веществу синька при лечении стоматита может давать побочные эффекты. Чаще всего у пациентов в таких случаях наблюдаются сильное раздражение слизистой и покраснение во рту. Побочные эффекты от данного средства проходят после окончания его применения.

У лиц со сниженным иммунитетом, а также у детей от года при передозировке синькой может наблюдаться расстройство желудка. При появлении такого симптома больным нужно немедленно обратиться к врачу. Он назначит лекарство для купирования этого состояния и заменит синьку другим средством для полоскания.

Если пациенту по каким-то причинам не подходит препарат, его можно заменить аналогами. Таковыми являются:

  • Гидроперит. Таблетки для приготовления антисептического раствора. Используются для полоскания полости рта при стоматитах;

  • Калия перманганат. Антисептическое средство для обработки слизистой;
  • Миристамид. Бесцветная антисептическая жидкость, разрушающая микроорганизмы. Используется при различных формах стоматита;
  • Натрия тетраборат. Прозрачная дезинфицирующая жидкость, используемая в стоматологии, гинекологии, хирургии.

Не следует проводить замену одного препарата на другой самостоятельно. Если вы решите использовать аналог синьки, обязательно обратитесь к врачу, назначившему вам это лекарство, и согласуйте замену с ним.

Подробности о применении синьки при лечении стоматита смотрите на видео

  1. Синька – антисептическое средство, основным действующим компонентом которого является метилтиониния хлорид.
  2. Препарат применяется в стоматологии для лечения бактериального, грибкового, герпетического стоматита.
  3. Основными противопоказаниями к его применению является повышенная чувствительность к средству, беременность, малый возраст пациента.
  4. Для обработки слизистой используют водный раствор синьки. Им обрабатывают пораженные участки рта, а также близлежащие ткани. Также средство используют для полоскания ротовой полости.
  5. Курс лечения синькой составляет от 5 до 10-ти дней. Точный срок лечения определяется врачом с учетом состояния больного, типа стоматита, а также наличия сопутствующих заболеваний. Полоскания можно сочетать с прижиганием проблемных участков. Больше подробностей о том, чем прижечь стоматит читайте тут.

Стоматит и Мирамистин: как правильно применять при лечении язв во рту

Винилин: инструкция по применению при стоматите у детей и взрослых

Метрогил Дента при стоматите: инструкция по применению для взрослых и детей

Солкосерил при стоматите: инструкция по применению геля для полости рта

Лечение стоматита — FDC Французская стоматологическая клиника

Стоматит — самое известное и наиболее часто встречающееся заболевание полости рта. Лечение стоматита можно разделить на две большие категории: местное и общее. Многие клиники Москвы занимаются местным лечением стоматита, для чего используются современные медикаментозные средства и препараты.

Несмотря на то, что само заболевание хорошо поддается лечению и довольно подробно изучено, до сих пор не удалось однозначно установить причины его возникновения и обострения, а также научиться прогнозировать периодику этих самых осложнений и ремиссий.

Лечение стоматита у взрослых и детей

Наиболее вероятными причинами возникновения стоматита является ослабление иммунитета и чрезмерное развитие микрофлоры в полости рта. Только опытный стоматолог может выявить верную причину проявления заболевания. И именно от того, насколько правильны выводы, зависит эффективность назначенного лечения. Могут использоваться иммуностимулирующие, противомикробные, противогрибковые, противовирусные препараты и препараты против аллергии.

Известны случаи, когда неверно назначенное лечение приводило к генерализации инфекции и провоцировало серьезные осложнения. В зависимости от стадии и формы заболевания лечение может выражаться:

  • в щадящей диете (как правило, исключаются пряности, острая и жирная пища)
  • в частом полоскании рта специальными растворами или даже водой (точнее может сказать только стоматолог)
  • в использовании средств местной анестезии
  • в применении средств для повышения слюноотделения (например, обычных леденцов или жевательной резинки)
  • в смазывании раны синькой
  • в обработке специальными медикаментозными средствами.

Нередко лечение стоматита у взрослых вообще не требуется — он проходит сам собой в течение недели. С детьми ситуация другая. Здесь даже выбор препарата без строго контроля врача опасен для здоровья. Применяются:

  • антибиотики
  • противовирусные препараты
  • противоспалительные вещества (вплоть до ромашкового настоя)
  • содовые повязки и компрессы.

Признаками стоматита у детей является повышенная раздражительность, отсутствие аппетита, нарушение сна, опухоль и изменение цвета полости рта, появление афт и язв (в зависимости от формы заболевания). При обнаружении признаков стоматита необходимо немедленно обратиться к педиатру или стоматологу. Чем раньше, тем лучше!

Симптомы стоматита

Стоматологи занимаются только местным лечением. Как правило, благодаря их стараниям удается избавиться от симптомов стоматита в полости рта. Лечение симптомов стоматита подразумевает:

  • антисептическую обработку полости рта
  • удаление омертвевших участков тканей
  • заращение язв и афт
  • снятие опухоли, воспаления, раздражения, боли
  • нормализацию слюноотделения (у детей).

Детский стоматит проявляется еще в виде повышенной плаксивости, раздражительности, в нарушении сна и в отсутствии аппетита, болезненных ощущениях при глотании. При игнорировании симптомов, отказе от лечения стоматит может развиваться. Так, герпетический стоматит способен перекинуться на пищевод и глотку.

Эффективное лечение стоматита у взрослых и детей

Эффективное лечение стоматита у взрослых и детей возможно только при условии контроля всех процедур профессиональным врачом. Клиники современной стоматологии предлагают услуги квалифицированных врачей — специалистов по лечению стоматита у взрослых и детей. Что они могут гарантировать?

  • Симптомы стоматита обычно проходят сами, как правило, в течение 7–10 дней. При  участии врача этот срок будет сокращен до 2–5 дней
  • Продолжительность ремиссии при ХРАС иногда длится всего несколько дней или недель. Под наблюдением специалиста и при условии выполнения всех его предписаний, её продолжительность составит месяцы, и даже годы
  • Тяжесть осложнений заболевания будет снижена — никаких болезненных ощущений, нарушений сна, а облегчение наступает после первого посещения стоматического кабинета
  • Используются самые современные методы диагностики заболевания и причин его возникновения. Распознается стоматит на самых ранних его этапах и подберается эффективное средство противодействия
  • Коллегиальная форма лечения. После местного лечения и снятия симптомов стоматита, Вас направят к другим специалистам: иммунологу, терапевту, педиатру и т.д.

Поэтому, можно быть абсолютно уверенным, что используя опыт и знания специалистов, современные медикаментозные средства и новейшие технологии, можно победить стоматит и вернуть Вам здоровье, а Вашей улыбке красоту!

Здоровые зубы и крепкое здоровье

FDC станет для вас и вашей семьи приятной находкой на пути к безупречной эстетике и крепкому здоровью.


Лечение стоматита - детское отделение ОН Клиник Харьков Дворец Спорта

Стоматитом называется инфекция ротовой полости, при которой слизистая оболочка рта раздражается и воспаляется. Стоматит у ребенка проявляется по-разному, в зависимости от причин, вызвавших инфицирование.

Как выглядит стоматит у детей?

Стоматит у детей до года развивается из-за несовершенного и более слабого (по сравнению со взрослым) иммунитета, выраженного сосательного рефлекса и тонкой слизистой оболочки рта. В этом возрасте малыши «пробуют все на вкус», что и приводит к постоянным травмам и ссадинам во рту. В них начинает активно развиваться патогенная микрофлора, что и вызывает заболевание.

Стоматит на языке у ребенка старшего возраста часто возникает из-за неправильного прикуса и скученности зубов, при употреблении слишком горячей или холодной пищи. Также часто болезнь развивается на фоне ОРВИ и других респираторных инфекций, когда нарушена нормальная работа дыхательной системы и ослаблен иммунитет.

Признаки стоматита у детей зависят от патогена, вызывающего инфекцию.

В зависимости от этого врачи выделяют следующие виды болезни:

  • кандидозный стоматит у детей – развивается из-за грибка рода Candida. Для него характерно появление белого налета на языке, появляется неприятный запах изо рта. Инфекция причиняет сильное беспокойство, грудной ребенок может отказываться от еды;
  • герпетический стоматит у детей вызывает вирус герпеса. Основные симптомы: появление во рту мелких язвочек (могут быть заполнены жидкостью), общая слабость, головная боль. Возможны боли в мышцах;
  • афтозный – еще один специфический вид болезни, при котором на слизистой появляется одна язва, покрытая серовато-белым или желтоватым налетом. Вокруг повреждения обычно развивается ярко-красное воспаление.

Инфекция может возникнуть и по более специфичным причинам: например, как последствие лучевой или химиотерапии.

Чем опасен стоматит у детей?

Воспаление слизистой оболочки рта часто приводит к тому, что малыши отказываются от еды, теряют вес, становятся плаксивыми и капризными.

Но заболевание опасно еще и тем, что часто приводит к распространению воспаления на соседние ткани и вызывает:

Чтобы предотвратить развитие осложнений, необходимо подобрать правильное лечение стоматита у ребенка.

Как обезболить стоматит у детей?

Язвы причиняют больному сильный дискомфорт: он не может нормально пить и есть, постоянно чувствует жжение. Для снятия неприятных симптомов используются местные обеззараживающие средства и анестетики. Один из наиболее известных «рецептов»: синька при стоматите. Ее раствором либо локально обрабатывают язвочки, либо полощут рот.

Но самолечение опасно. Запущенная форма стоматита приводит к сильной лихорадке, может вызвать развитие тяжелых болезней. Оптимальное решение – это обращение к врачу, который диагностирует инфекцию, установит причину ее возникновения, расскажет, как быстро вылечить стоматит у ребенка.

Сколько длится стоматит у детей?

Скорость выздоровления зависит от причин, вызвавших болезнь, и общего состояния пациента. Лечение в домашних условиях может занимать больше месяца и при этом привести к серьезным осложнениям. Лечение стоматита у ребенка под контролем опытного педиатра длится не более 7-10 дней и позволяет добиться полного восстановления здоровья.

Какой врач лечит стоматит у детей?

Диагностировать и вылечить патологию может детский врач – педиатр. Для этого достаточно записаться на прием по контактному номеру телефона медицинского центра «ОН Клиник Харьков Дворец Спорта».

Как называется синька от стоматита. Для чего нужна синька для белья? – состав и инструкция по применению

Водный раствор метиленового синего, который больше известен под названием синька, часто применяется для лечения стоматита. Препарат относится к группе антисептических средств, используемых для местного наружного применения. Благодаря отсутствию в составе спирта средство не обжигает слизистую оболочку ротовой полости и не может вызвать отравления. Поэтому синька от стоматита довольно часто применяется для лечения стоматита у детей.

Хранить препарат необходимо в темном месте, недоступном для детей.

Противопоказания к применению

Согласно сведениям, которые содержит инструкция к данному препарату, синьку не рекомендуется использовать:

  • При индивидуальной чувствительности к составляющим компонентам препарата;
  • Для лечения стоматита у детей в возрасте до одного года;
  • Для лечения стоматита у беременных и в период кормления грудью.

Совет! Индивидуальная непереносимость препарата проявляется головной болью, общим психологическим дискомфортом и возникновением кожных аллергических реакций. В таких случаях от применения синьки следует немедленно отказаться.

Замечено, что риск возникновения побочных эффектов в значительной степени возрастает при очистке синькой поврежденных участков большой площади. Кроме того, следует знать, что при использовании препарата могут возникнуть расстройства со стороны пищеварительного тракта.


Также в инструкции содержится предупреждение о возможном негативном воздействии препарата на мочеполовую систему. При передозировке препарата рекомендуется проведение стандартной симптоматической терапии.

Лечение стоматита с помощью синьки

Синька может применяться для лечения стоматита как у взрослых, так и у детей. Способы ее использования всецело зависят от степени тяжести заболевания и его клинических проявлений. При остром и хроническом стоматите синька применяется для обработки всей слизистой оболочки ротовой полости. Для этого используется ватно-марлевый диск, предварительно смоченный в растворе.

Совет! Перед процедурой обработки необходимо удалить налет с имеющихся язв с помощью тампона, смоченного в одном из таких натуральных масел:

  • Облепиховом;
  • Шиповниковом;
  • Льняном;
  • Персиковом.


При проведении лечения стоматита синькой следует знать, что обработка пораженных участков должна проводиться ежедневно, причем:

  • У взрослых допускается проводить очистку язв до 10 раз в день;
  • У детей старшего возраста обработка пораженных участков выполняется не чаще 4 раз в день, а у малышей до 6 лет – не чаще 2 раз в день.


Также важно знать, что:

  • Лечение стоматита в острой форме с помощью синьки длится, в большинстве случаев, неделю. При этом водный раствор метиленовой сини применяется до полного устранения язвенных дефектов на слизистой оболочке ротовой полости.
  • Хроническая форма стоматита лечится довольно долго, в течение 2-3 недель. Поэтому полная обработка слизистой оболочки ротовой полости синькой выполняется только на начальной стадии, а в дальнейшем, с целью предотвращения раздражения, необходимо перейти на точечную обработку отдельных язв.

Совет! Эффективность лечения синькой стоматита повышается в случае, если препарат используется в сочетании с йодинолом или холисалом.

Синька при лечении стоматита раньше использовалась очень часто. Можно с уверенностью утверждать, что это проверенное годами средство. Но сегодня, несмотря на минимум противопоказаний и неплохую эффективность препарата, предпочтение при лечении воспаления слизистой оболочки ротовой полости чаще отдается другим антисептическим препаратам.

Это связано с тем, что в настоящее время имеется ряд более быстродействующих препаратов, для устранения неприятных и болезненных клинических проявлений стоматита. Но при этом многие доктора признают, что в ряде случаев лечение заболевания синькой оказывается более эффективным.

Раствор метиленового синего, больше известный в широких массах как синька, является эффективным антисептическим средством.

Он обладает отличным бактерицидным и ранозаживляющим действием, поэтому его часто используют при .

Отсутствие спирта в составе исключает вероятность отравлений или ожогов слизистой. При лечении синькой медицинской, инструкция которой подробно описывает показания и противопоказания, следует обратить внимание на возможные побочные действия.

Особенности препарата

Основным действующим компонентом медицинской синьки является метилтиония хлорид. Дополнительным веществом выступает дистиллированная вода.

Механизм действия заключается в способности антисептика соединяться с патогенными бактериями и нейтрализовать их пагубное воздействие. В итоге в полости рта уничтожаются все вредные микробы.

Раствор метиленового синего

Синька от стоматита (отзывы об эффективности препарата довольно впечатляющие) применяется местно на поврежденную кожу (в том числе и слизистую оболочку), и поскольку он не проникает в кровь, то не может вызвать токсические отравления. А значит, печень и другие органы не могут пострадать.

Метиленовая синька при стоматите применяется в виде 1% водного раствора, который не вызывает неприятного ощущения во рту и не приводит к ожогам слизистой.

Из-за ярко синего цвета препарат обладает окрашивающими свойствами. Поэтому синька медицинская применение имеет точечное, и при манипуляциях рекомендуется пользоваться перчатками.

И внутривенно, и наружно

Свойства метиленового синего позволяют использовать его в различных областях медицины наружно и внутривенно. Он представляет собой кристаллический порошок, из которого можно приготовить спиртовой или водный раствор.

Медицинская синька рекомендуется к применению в качестве местного средства в следующих случаях:

  • при различных повреждениях кожного покрова – наружно путем смазывания участков спиртовым раствором;
  • как антисептик для промывания зараженных полостей;
  • при воспалениях слизистых оболочек или кожного покрова;
  • синьку используют при мочеполовых заболеваниях непосредственно для промывания уретры.

Внутривенно медицинская синька назначается:

  • для диагностирования или лечения почечных патологий;
  • при отравлениях сероводородом, угарным газом или цианистыми соединениями синька используется в качестве антидота;
  • внутрь препарат назначается при лечении цистита или уретрита;
  • инъекции синьки медицинской в комплексе с новокаином делаются внутримышечно при хроническом дерматозе.

При введении внутрь, синька медицинская выделяется из организма вместе с мочой, окрашивая ее в ярко синий цвет. Тем самым можно оценить выводящую способность почек и диагностировать возможные патологии.

Как применять препарат?

Синька от стоматита (цена, к слову, данного препарата самая что ни есть демократичная) разрешена к применению взрослым и детям, начиная с рождения.

При таком заболевании, как стоматит, лечение синькой зависит от клинических особенностей, степени тяжести недуга и возраста пациента.

Хронический или лечится путем обрабатывания всей слизистой оболочки рта.

Перед использованием синьки медицинской следует удалить белый налет при помощи тампона, смоченного в , льняном или персиковом масле. После ватный диск смачивают в 1% водном растворе и закладывают в ротовую полость.

Эффективность синьки медицинской проверена годами. Такое антисептическое средство способствует снятию воспаления и предотвращает от повторного заражения. При острой форме курс лечения составляет до 7 дней, а при хронической – до 3 недель. Раствор необходимо применять до полного устранения язвочек.

Лечение стоматита будет иметь положительный результат при условии, что пораженные участки обрабатываются ежедневно.

Взрослым

Перед определением терапевтического курса специалист осматривает ротовую полость и ставит окончательный диагноз. При стоматите назначается комплексная терапия, включающая противовирусные и жаропонижающие препараты, а также обработку синькой медицинской.

Частота обрабатывания ротовой полости лекарственным средством зависит от:

  • тяжести и формы заболевания;
  • состоянии иммунной системы;
  • наличия дополнительных патологий.

При остром стоматите на начальных этапах синькой обрабатывается вся ротовая полость. По мере улучшения состояния препарат следует наносить точечно при помощи ватной палочки. Это поможет избежать появления раздражения слизистой оболочки.

Если передерживаться инструкции при стоматите, метиленовая синька поможет ранкам затянутся на 3-4 день. В качестве дополнения к основному терапевтическому курсу врач может порекомендовать обрабатывать ротовую полость настоями лекарственных трав. Это поможет ускорить процесс заживления язвочек.

Детям

Синька при стоматите у детей назначается только лечащим врачом (стоматологом или педиатром).

Из-за отсутствия способности накопления в крови, она разрешается даже новорожденным детям.

Метиловый синий оказывает эффективное действие только при , который вызывают различные микробы.

В этом случае на повреждения ротовой полости препарат нужно наносить точечно. Обрабатывать пораженные участки детям до 6 лет следует 2 раза в сутки, а старшего возраста – 4 раза.

Одним из часто встречающихся видов стоматита в детском возрасте является герпетический. Но это вирусное заболевание не лечится при помощи синьки медицинской. Поэтому препарат можно использовать в качестве дополнения к основной терапии, которая основывается на приеме противовирусных препаратов. Синька же поможет защитить полость рта от повторного заражения микробами.

При лечении грудничков от стоматита метиленовый синий лучше наносить на соски кормящей мамы, чтобы не травмировать нежную слизистую малыша ватными тампонами.

Прицельное применение в стоматологии

Метиленовый синий в стоматологии выступает в качестве эффективного антивоспалительного средства и антисептика.

Стоматит на губе

Его применяют в случае развития в ротовой полости бактериальной, грибковой или вирусной инфекции. Водным раствором можно обрабатывать как поврежденные участки слизистой оболочки, так и здоровые ткани без риска их повреждения.

Синька при лечении стоматологических заболеваний назначается в зависимости от клинической картины и поставленного врачом диагноза, выделяются следующие схемы лечения:

  • при стоматите производятся точечные прижигания язвочек 1% водным раствором. Таким образом, на поврежденной поверхности образуется защитная пленка, при помощи которой ускоряется регенерация тканей. Частота обработки определяется врачом, она зависит от возраста пациента и стадии заболевания;
  • при пораженные участки слизистой десен смазываются 1% водным раствором;
  • для лечения молочницы синька является незаменимым средством, которое вызывает гибель патогенной микрофлоры и предотвращает повторное возникновение проблемы. Кратность обработки зависит от тяжести процесса.

Возможность побочных действий

Метиловый синий, как и любой лекарственный препарат, имеет противопоказания к применению.

Метиленовая синька не рекомендована к применению в случае:
  • индивидуальной непереносимости или аллергических реакциях на один или нескольких компонентов лекарственного средства;
  • во время беременности или кормления препарат можно использовать только в случае, если польза для матери от использования будет больше, чем возможного вреда малышу;
  • при стоматите у ребенка в возрасте до года, синьку следует наносить осторожно, точечно и только с разрешения врача.

Поскольку попасть в кровь синька не может, то побочные действия могут возникнуть на фоне передозировки или из-за компонентов самого препарата.

Среди возможных системных проявлений выделяются:

  • головная боль;
  • снижение аппетита;
  • кожные аллергические реакции;
  • тошнота или рвота;
  • анемия;
  • нарушения в работе мочеполовой системы;
  • психологический дискомфорт;
  • расстройства со стороны пищеварительной системы.

Специалисты отмечают, что риск возникновения отрицательных реакций увеличивается, если обрабатывать большие участки слизистой оболочки рта.

При появлении побочных действий необходимо сразу прекратить использование препарата. А в случае передозировки препаратом нужно проводить симптоматическое лечение.

Видео по теме

Где купить синьку от стоматита? Здесь все просто: препарат продается практически в каждой аптеке. Также рекомендуем познакомиться с не менее эффективными способами борьбы со стоматитом в домашних условиях:

На основе многолетних наблюдений было замечено, что синька при лечении стоматита дает очень высокие результаты. Благодаря широкому спектру действий средство рекомендовано во всех детских больницах.

Средство выпускается в трех формах: в виде порошка, на спирту, на воде. Для лечения слизистых оболочек используют только водные растворы. Отсутствие спирта в лекарстве позволяет применять его не только взрослым пациентам, но и при стоматите у детей.

Механизм действия синьки при стоматите

Антисептик метиленовый синий в виде раствора быстро проникает в ткани. При этом они приобретают характерный цвет. Лечебное действие обусловлено возможностью активного вещества связываться с клетками. В этот момент происходит выработка нерастворимых соединений с белками патогенной микрофлоры. Таким образом, синька угнетает бактерии, блокирует размножение вредоносных организмов.

Применение синей жидкости от стоматита не вызывает интоксикации, так как активные компоненты не попадают в кровеносную систему. С уничтожением возбудителей – останавливается инфекционный процесс.

Инструкция по применению синьки при стоматите

Раствор метиленовой сини при стоматите разрешен к применению детям и взрослым людям. Определять способ лечения и продолжительность курса должен только врач.

При этом он учитывает следующие факторы:

  • клиника стоматита;
  • степень тяжести заболевания;
  • возраст пациента.

Обычно в момент острой и хронической стадий назначают обработку всей площади слизистой оболочки. Единичные высыпания можно смазывать точечно.

Инструкция применения синьки от стоматита для взрослых:

  1. Предварительная обработка ротовой полости заключается в удалении белого налета. Для этого оберните указательный палец стерильной марлевой салфеткой, протрите пораженные участки. Предварительно тампон необходимо смочить в содовом растворе (1 ч. л. на стакан воды) или в облепиховом масле.
  2. Если врач назначил обработку всей слизистой оболочки, то протрите ее стерильной салфеткой, смоченной раствором синьки. При точечном способе подразумевается смазывание лекарством только пораженных участков. Используя ватные палочки, обработайте синькой язвочки, захватывая немного здоровой ткани вокруг ран.
  3. Взрослым пациентам врачи рекомендуют проводить процедуры не менее 10 раз в день. В некоторых случаях назначают обработку ран синькой через каждые 1–1,5 часа (но не более 15 раз в сутки).

Стоматит требует комплексного подхода к лечению. Вместе с синькой, пациентам назначают жаропонижающие средства, противовирусные и иммуномодулирующие препараты. Переход на щадящую диету позволит ускорить выздоровление.

При соблюдении всех правил применения синьки облегчение наступает уже на 3–4 сутки. Курс лечения острой формы стоматита составляет неделю. А хроническая стадия требует более длительной обработки (до 20 дней).

Инструкция лечения синькой стоматита у детей несколько отличается. Рассмотрим алгоритм действий:

  1. Назначать применение препарата должен только врач. Прежде всего, ребенка показывают педиатру или стоматологу. Определив тип возбудителя, доктор подбирает эффективную терапию. Дело в том, что сама синька способна уничтожить только бактериальные формы стоматита. Вирусные возбудители нейтрализуют соответствующими препаратами. В этом случае синька выступает вспомогательным лекарством.
  2. Перед использованием препарата необходимо удалить белый налет с пораженных участков. Делайте это таким же способом, как описано выше. Удаляя налет, часто меняйте тампоны.
  3. Антисептическую жидкость наносят в детском возрасте точечно, используя ватные палочки. Малышам младше 6 лет назначают 2 процедуры в день. Детям старшего возраста разрешено 4 обработки в сутки. Учитывая индивидуальные особенности, доктор может назначить иное количество процедур.
  4. В грудном возрасте обработку при помощи ватных палочек не рекомендуют. Лучше нанести несколько капель синьки на сосок матери перед кормлением. Количество процедур в день назначает врач.

Выздоровления можно добиться только при ежедневном применении препарата. При соблюдении всех рекомендаций доктора, заживление ран происходит уже на 3 день. Полное выздоровление наступает на 6–7 сутки. Хронические стадии стоматита требуют более длительного применения синьки (14–21 день).

Есть ли противопоказания?

При стоматите раствор метиленовой сини применяют уже давно. Это дало возможность изучить все возможные риски и определить наличие противопоказаний. Их немного:

  • индивидуальная непереносимость активного вещества;
  • период беременности и вскармливания грудью ребенка.

Несмотря на гипоаллергенность синьки, в редких случаях она не принимается организмом пациента. Также детям, не достигшим годовалого возраста, препарат назначают с осторожностью.

Возможные побочные эффекты

Синька от стоматита в ходе лечения редко вызывает неприятные последствия. Благодаря особенности препарата не адсорбироваться кровотоком, побочные реакции возникают лишь на фоне индивидуальной непереносимости или передозировки.

Заметив систематические проявления следующих симптомов, необходимо срочно прекратить обработку слизистой оболочки синькой:

  • Головокружение или мигрени.
  • Тошнота, рвота.
  • Проявление психологического дискомфорта (чувство тревоги, нервозность, плаксивость).
  • Нарушается работа мочеполовой системы.
  • Дисфункция желудочно-кишечного тракта.

Также необходимо подготовиться к тому, что синька при стоматите окрашивает зубы и губы в характерный цвет. Поэтому в ходе лечения будет нарушена эстетичность внешнего вида пациента.

Исследования и многолетняя практика доказывают эффективность метиленового синего при стоматите. В большинстве случаев удается быстрее достичь выздоровления, если сравнивать с терапией препаратов антибактериальной группы. К тому же цена лекарства достаточно демократична, что делает его доступным для всех слоев населения.

Полезное видео про стоматит у детей

Окрашивание ткани джинсы, не только брюк, но и других вещей, пошитых из денима, способно дать этим вещам новое воплощение и вторую жизнь. Для проведения данной процедуры сгодится не только привычная синька, да и окрашивать можно как голубые и синие, так и серые или белые джинсы.

Применение синьки

Разведите синьку в 3-4 литрах теплой воды, температура которой не превышает 30-35 градусов. Добавьте две больших ложки соли и влейте синьку. Количество вещества определяйте по собственным предпочтениям: чем больше синьки, тем насыщеннее и темнее будет цвет. Замочите в растворе джинсы и переворачивайте их через каждые полчаса. По истечению 4 часов вещь ополаскивается в большом количестве холодной воды, а после ополаскивается уксусным раствором (1 большая ложка на литр воды).

Профессиональные краски

Для получения более профессионального итога необходимо применять краски для тканей. Для правильного окрашивания и лучшего впитывания пигмента джинсу следует прокипятить в воде (4-5 литров) вместе с краской, добавив в нее две столовые ложки соли, а после процедуры необходимо ополоснуть джинсу в уксусном растворе. При процедуре подойдет просторная посудина, в которую вещь поместится полностью. Лучше всего использовать бак для белья или алюминиевый таз. Во время кипячения раствор нужно регулярно помешивать, чтобы не было разводов на ткани. Как правило, производители красок и сами указывают на упаковках подробное описание процедуры и все пропорции. Старайтесь соблюдать дозировку, так как излишки будет сложно удалить.

Использование марганцовки

Другой способ окрасить джинсу заключается в применении марганцовки, что дает пурпурный оттенок. Ткань, которая получалась в результате такого окрашивания, была популярна в восьмидесятые годы прошлого века. Сегодня этот оригинальный дизайн снова в моде. Вещь кипятить не нужно. Смесь перманганата калия нужно перемешать с уксусом и обработать полученной смесью джинсы. После этого таблетки гидроперита измельчают в порошок, добавляют в воду и губкой закрепляют рисунок.

Окрашивание белизной

Опустите джинсы в ведро с горячей водой, куда предварительно было добавлено 150-200 грамм белизны. Начинайте кипятить, все время помешивая. Джинса не должна всплывать. Такой метод позволит придать синим джинсам красивый светло-голубой с белым оттенок, но с его помощью можно придать брюками интересный дизайн, получив разводы на ткани. Для этого опускаются в раствор только штанины, их можно скрутить, это даст абстрактный узор, а можно прищепками сделать рисунок. Место, где будет прищепка, не окрасится.

При работе с этим и любыми другими растворами нужно соблюдать меры безопасности: применять перчатки, помешивать палкой, не контактировать с химикатами напрямую.

Разноцветное окрашивание

Джинсы можно покрасить не в один цвет, а сделать их необычными и яркими. Для этой цели используют специальные акриловые краски разных цветов. Пока они жидкие, их можно разбавлять водой для получения нужного оттенка.

Водный раствор метиленового синего, известный как «синька» — антисептический препарат, применяемый для наружного нанесения на кожу и слизистые оболочки. Отсутствие в составе спиртового компонента позволяет использовать синьку при стоматите даже у детей, так как отсутствует риск отравления или ожога в ротовой полости. Средство следует применять четко по инструкции.

Состав

Препарат выпускается в нескольких формах – порошок, спиртовой и водный раствор. В рамках терапии стоматита применяется водная форма, состоящая из:

  • метилтиониний хлорид – 1 грамм;
  • вода очищенная – 100 мл.

Предлагается препарат во флаконах по 25,50 и 100 мл. В форме уже разведенного раствора срок годности средства — 3 года, храниться он должен в темном месте.

Свойства синьки

Препарат обладает общим обеззараживающим и окислительно-восстановительным действием, активно применяется в качестве противоядия при отравлениях ядами. Механизм действия антисептика основан на его способности соединяться с белками бактериальных клеток, тем самым нейтрализуя сами бактерии. В общий кровоток при местном нанесении препарат не попадает, что исключает его токсическое воздействие на организм. Допускается использование как наружно, так и вовнутрь (для промываний при уретрите и цистите).

Способ применения

Особенность лекарства – насыщенный синий цвет, который легко окрашивает ткани. В силу этого любые манипуляции рекомендуется производить в перчатках. Обработанные слизистые раствором обязательно станут синего цвета (особенно в области губ и горла). Способы применения раствора зависят от сложности ситуации и выраженности клинических проявлений стоматита.

Для взрослых

Прежде чем использовать синьку, необходимо получить консультацию врача и точно установить диагноз. В зависимости от запущенности картины болезни, метиленовый синий может применяться как единственный метод лечения, и как элемент комплексного воздействия (совместно с противобактериальными и жаропонижающими средствами).

Предварительно пораженную область обрабатывают маслом дня снятия сформировавшегося налета. Для процедуры подойдет масло шиповника, льна или облепихи, им смачивают ватный диск и осторожно протирают язвы. Далее наносят саму синьку – точечно, используя ватную палочку.

Взрослым пациентам обработку пораженных участков слизистой проводят до 15 раз в день. Язвы начинают заживать уже через 3 дня терапии, полное выздоровление при остром стоматите занимает неделю, а при хроническом — 20 дней.

Для детей

Способ применения синьки от стоматита для ребенка не отличается от рекомендаций для взрослых пациентов:

  • предварительно пораженные участки слизистой обрабатывают маслом для снятия налета;
  • точечно наносят водный 1% раствор синего метиленового;
  • периодичность обработки до 6-ти лет – дважды в день, старше 6-ти – до 4 раз.
  • Лечение деток до годовалого возраста таким методом не производится.

Побочные эффекты

При наружном использовании аптечной синьки могут возникнуть аллергические реакции в виде покраснения, сыпи, чувства жжения и зуда. Для устранения проявлений используют симптоматическую терапию. С учетом отсутствия системного действия при точечном нанесении общих негативных реакций не наступает.

Противопоказания

Медицинская синька запрещена к использованию:

  • детям до года;
  • при наличии индивидуальной непереносимости.
  • Характерных взаимодействий с прочими лекарственными средствами не обнаружено.

Отзывы

Настя: У нас в аптеках синька практически пропала с полок! Не понимаю почему, замечательное средство! При стоматите помогает лучше всего!

Кристина: Очень простой, но действенный препарат. А самое главное, что абсолютно безопасный для ребенка, чего не скажешь про всякие противобактериальные таблетки.

Яна: Хороший антисептик, но от хронического стоматита меня не избавил. Помог только в рамках длительной комплексной терапии, назначенной врачом.

Хлоргексидин и его применение при стоматите


Аналоги средства

Если по каким-то причинам нельзя применять «Хлоргексидин» для полоскания десен, то можно заменить это лекарственное средство аналогами. Хорошими антибактериальными и противовоспалительными качествами обладают такие средства, как:

  • перекись водорода;
  • «Фурацилин»;
  • «Стоматидин»;
  • «Ротокан»;
  • «Орасепт»;
  • «Хлорофиллипт»;
  • «Мирамистин».

Все эти препараты не являются абсолютными аналогами «Хлоргексидина» и могут содержать в своем составе другие компоненты. Они применяются для проведения противовоспалительной и антисептической обработки ротовой полости.

Наиболее результативным средством считается «Мирамистин». Этот препарат не имеет никакого неприятного привкуса и очень быстро уничтожает болезнетворные микроорганизмы. Антисептик «Мирамистин» выпускается в удобном флаконе с распылителем. Он многократно усиливает действие антибиотиков при одновременном их применении.

Препарат «Стоматидин» – лекарственное средство, которое помогает результативно бороться с бактериями. Его разрешено применять даже при беременности и лечении маленьких детей. Оно почти что не имеет никаких противопоказаний.

В качестве альтернативных средств можно использовать природные антисептики, в частности календулу, ромашку, зверобой и шалфей. Однако стоит отметить, что терапевтический эффект их несколько ниже. Природные антисептики можно использовать даже для лечения воспаления десен у детей, так как даже при случайном проглатывании лекарственного средства ничего плохого не произойдет.


Свойства хлоргексидина

Хлоргексидин имеет также другое наименование – биглюконат. Он обладает антисептическими свойствами и действует на местном уровне, а именно:

  • Борется против микробов.
  • Уничтожает грибки.
  • Эффективен с вирусными патогенами.

При этом лекарство выпускается в нескольких формах – в виде пластыря, геля, спиртового раствора, раствора на основе воды, крема.

Стоматит, как правило, лечат именно жидким раствором. Помимо выраженного антисептического действия, хлоргексидин при стоматите также устраняет воспаления язвочек, даже если их количество велико. Кроме того, хлоргексидин в виде геля показан в виде аппликаций.

Препарат отличается мощными защитными характеристиками – на слизистой он формирует тонкую пленку, которая бережет слизистую от попадания микробов, вследствие этого лечение препаратом в виде раствора существенно помогает избавиться от воспаления в виде язвочек.

Лекарство не имеет противопоказаний при лечении детей, его безвредность давно доказана. Даже если ребенок нечаянно проглотит раствор, малышу это не навредит, если своевременно обеспечить меры по обезвреживанию.

Рекомендация! Следите, чтобы лечение хлоргексидином не длилось дольше 12 суток, в противном случае есть развития у малыша дисбактериоза полости рта – впоследствии его придется лечить.

Не забывайте также, что для борьбы с герпесным патогеном препарат не помогает. Лечить герпетический стоматит препаратом до конца нельзя, хлоргексидин эффективен лишь при несложных воспалительных процессах.

Видео по теме

Как правильно применять Хлоргексидин для полоскания рта:

Применять лекарство при воспалении десен можно только после удаления зубного камня и в составе комплексной терапии. При появлении любых необычных симптомов (кровоточивость десен, зубная боль и т. д.) следует обратиться к врачу для постановки диагноза и выбора способа лечения.

Применение Хлоргексидина в домашних условиях допускается, но только в качестве дополнения к основной терапии. Использовать один антисептик нельзя: симптомы воспаления стихнут, а патологические процессы продолжат развиваться.

Как правильно использовать хлоргексидин при стоматите у взрослых и детей?

Стоматит – сложное заболевание, сопровождающееся воспалением слизистой оболочки полости рта. У детей заболевание диагностируется особенно часто, поскольку маленькие детки познают окружающий их мир через рот, что называется, «на зубок». Идеально чистых поверхностей, увы, не существует, а потому слизистая из-за попавших на нее болезнетворных бактерий воспаляется очень часто.

Основной симптом стоматита – формирование болезненных язвочек, которые доставляют ребенку множество хлопот. Малыш не может полноценно есть, а иногда и разговаривать. Лечение стоматита предусматривает использование различных медицинских препаратов. Один из них – хлоргексидин.

Свойства препарата

Первый симптом стоматита – язвочки на слизистой рта. Они болезненные и вызывают сильный дискомфорт. Часто от них страдают дети. Малыши отказываются от еды, а иногда и от общения. Для борьбы со стоматитом применяется ряд лекарственных средств. В их числе и хлоргексидин.

Среди других препаратов подобного действия следует отметить хлорофилипт. Хлорофиллипт при стоматите эффективен и безопасен. Он используется для полосканий и аппликаций. При этом используется спиртовой раствор. Среди народных средств рекомендуется сода при стоматите.

Хлоргексидин используется для полосканий и аппликаций.

Она способна снимать воспаление, борется с инфекцией и способствует заживлению язв. Относительно применения любого из этих средств нужно посоветоваться со стоматологом. Важно определить, почему развился стоматит, и уже основываясь на этом назначать лечение.

Читать также: Но шпа от зубной боли при беременности

Врачи назначают хлоргексидин при стоматите очень часто. Хлоргексидин (хлоргексидина биглюконат) – препарат антисептический. У него отмечаются такие свойства:

  • способен подавить активность микробов;
  • борется с грибком;
  • эффективен против вирусов.

Средство подавляет активность сразу трех групп вредителей, которые становятся причиной многих заболеваний.

Средство выпускается в виде раствора (спиртового или водного), крема, геля, пластыря. Для борьбы со стоматитом чаще всего применяется препарат в жидкой форме. Это связано с тем, что он используется для регулярных полосканий. Для нанесения аппликаций также может назначаться гель.

Эффективный аналог Хлоргексидина.

Хлоргексидин очень часто назначается именно от стоматита. Мощное действие препарата связано с тем, что он создает на пораженной поверхности защитную пленку. Она становится надежной защитой язвочек и воспалений от вездесущих бактерий. Применение препарата значительно ускорит заживление. Это доказано практикующими стоматологами.

Как правильно подготовить раствор

Согласно инструкции по применению «Хлоргексидина» для полоскания зубов, концентрированный раствор предварительно нужно развести водой. В основном в аптеках продается средство 0,05%. Он уже готов к применению и его не нужно разбавлять.

Если препарат более концентрированный, то перед применением его нужно предварительно развести водой. При концентрации средства 0,2 % нужно взять 2,5 мл лекарства и растворить его в 1 литре воды. Она должна быть кипяченой или дистиллированной.

Важно помнить, что полоскать рот нужно только теплой жидкостью, так как горячая может обострить протекание воспалительного процесса, а холодная довольно сильно сузить кровеносные сосуды слизистой, при этом терапевтический эффект будет минимальным. Стоит отметить, что приготовленное средство нельзя слишком долго сохранять, поэтому лучше каждый раз готовить новую, небольшую порцию.

Предлагаем ознакомиться Как правильно выбрать детскую зубную пасту

Меры предосторожности

Бактерицидное действие усиливается с повышением температуры. При температуре выше 100 °C лекарственное средство частично разлагается. Попадание гипохлоритных отбеливающих веществ на ткани, которые ранее находились в контакте с содержащими хлоргексидин препаратами, может способствовать появлению на них коричневых пятен.

У пациентов с открытой черепно-мозговой травмой, повреждениями спинного мозга, перфорацией барабанной перепонки следует избегать попадания на поверхность головного мозга, мозговых оболочек и в полость внутреннего уха. В случае попадания на слизистые оболочки глаза их следует быстро и тщательно промыть водой.

Не рекомендуются одновременное применение с йодом.

Применение у детей. Использование раствора хлоргексидина (водного или спиртового) у новорожденных как кожного антисептического средства перед проведением инвазивных процедур связано с определенным риском развития химического ожога. На основании данных спонтанного репортирования и литературных данных был выявлен более высокий риск кожных реакций у недоношенных новорожденных, в особенности рожденных до 32 недель беременности, у которых хлоргексидин применялся в течение первых двух недель жизни.

Перед проведением инвазивных процедур необходимо удалить все материалы, смоченные хлоргексидином: бинты, простыни, салфетки, халаты и т.д. Не следует использовать чрезмерное количество раствора. Не следует допускать скопление раствора в кожных складках, под телом пациента, на материалах, которые находятся в непосредственном контакте с кожей ребенка.

Если герметичную повязку (окклюзионную повязку) необходимо наложить на кожные покровы, ранее подвергшиеся воздействию хлоргексидином, до наложения повязки необходимо убедиться в отсутствии избыточного количества раствора хлоргексидина на коже.

Применение у людей пожилого возраста. Данные касающиеся особенностей применения у пожилых пациентов отсутствуют.

Применение во время беременности и в период лактации

Следует с осторожностью использовать у беременных и кормящих женщин из-за отсутствия данных об опыте клинического применения. Не обрабатывать поверхность молочных желез перед кормлением.

Влияние на способность к управлению автотранспортом и другими потенциально опасными механизмами

Взаимодействие с другимилекарственными средствами

Не совместим с детергентами, содержащими анионную группу (сапонины, натрия лаурилсульфат, натрия карбоксиметилцеллюлоза). Не рекомендуется одновременное применение с йодом.

Присутствие мыла может инактивировать хлоргексидина биглюконат, поэтому перед использованием лекарственного средства остатки мыла необходимо тщательно смыть. Этанол усиливает эффективность лекарственного средства.

Механизм работы хлоргексидина

Когда человек обрабатывает полость рта хлоргексидином, препарат оседает на слизистой в виде тонкой пленки. Она еще несколько часов сохраняется на тканях полости рта, продолжая защищать их от воздействия патогенных микроорганизмов.

Предлагаем ознакомиться Уход за съемными зубными протезами, как хранить, таблетки, щетки, зубные пасты, обзор

Данный механизм работы обеспечивает высокую концентрацию препарата на поврежденных тканях. Именно это делает хлоргексидин биглюконат одним из самых эффективных препаратов, и значит, это именно то, чем полоскать рот, если воспалилась десна.

Так же данный препарат используется при следующих проблемах:

  • гингивит;
  • пародонтит;
  • стоматит;
  • при воспалительных процессах после удаления зуба;
  • при воспалительных процессах капюшона, располагающегося над зубом мудрости;
  • во время дезинфекционной обработки зубных протезов.

Противопоказания препарата

Как и у многих других лекарств, у Хлоргексидина есть ряд противопоказаний. Его ни в коем случае нельзя принимать беременным и кормящим грудью мамочкам, не рекомендуется также принимать лекарство и детям, не достигшим пятилетнего возраста. Особую осторожность с препаратом необходимо иметь людям, которые жалуются либо жаловались на аллергию.

К побочным эффектам лекарства относятся:

  • переменное восприятие вкуса на неопределенное время;
  • изменение цвета слизистой оболочки и зубов;
  • раздражение кожного покрова;
  • отек слюнных желез.

Помимо лечебных свойств Хлоргексидина при стоматите, он обладает и иными. Данный препарат можно использовать и при других воспалительных процессах:

  1. Удаление зуба и воспаление десен.
  2. При заболеваниях горла: ангина, тонзиллит.

Как использовать Хлоргексидин после удаления зуба или воспаления десны


Препарат обычно назначает доктор-стоматолог после процедуры удаления зуба. Данное средство направлено на уничтожение бактерий, которые приводят к болезненным ощущениям и воспалительным процессам. Лекарство нужно применять не менее трех раз в день. Один процесс полоскания после удаления зуба обязан составлять не меньше минуты. Его интенсивность должна находиться на среднем уровне.

Полоскание при гингивите

При воспалении десен, как полоскать «Хлоргексидином» ротовую полость, изначально должен рассказать стоматолог, и после этого можно переходить к самостоятельному проведению лечебной процедуры. При отечности, которая возникает при протекании катарального гингивита, нужно проводить полоскание 0,05% раствором «Хлоргексидина» 2 раза в день после предварительной чистки зубов.

Стоит отметить, что чистка зубов при этом заболевании очень болезненная, и некоторые пациенты довольно невнимательно относятся к этой процедуре. Мягкий налет, накапливаясь на поверхности эмали, содержит множество патогенных микроорганизмов, постоянно провоцирующих воспаление десен. Чтобы избавиться от бактерий, нужно не только полоскать десны, но и особо тщательно чистить зубы, используя для этого щетку с мягкой щетиной.

Как полоскать «Хлоргексидином» при воспалении десен во время прорезывания зубов – этот вопрос интересует очень многих, так как важно правильно проводить лечебную процедуру, которая поможет избавиться от болезненности. Полоскания можно проводить только детям старше 7 лет. Именно поэтому это средство применяется для облегчения болезненности при прорезывании зубов мудрости. Оно помогает предотвратить распространение воспаления на всю оболочку десны и не допустить образования гноя.

Доктор рекомендует проводить полоскание антисептиком 2-3 раза в день. При сильной чувствительности к этому средству его рекомендуется разводить водой и использовать раствор в концентрации меньше 0,05 %.

Полоскание при стоматите

Применение «Хлоргексидина» для полоскания обязательно при такой болезни, как стоматит. Использование этого препарата способствует прекращению размножения бактерий. Проводить полоскание нужно 1-2 раза в день при тщательном соблюдении гигиены ротовой полости.

Обязательно нужно помнить то, что этот препарат совершенно несовместим с йодом. Курс проведения терапии составляет не более 10 дней. Очень важно совершенно точно знать, как полоскать десны хлоргексидином биглюконатом при протекании стоматита.

Можно даже использовать слабый раствор 0,02%. Нужно ли разводить лекарственное средство для полоскания рта при стоматите, во многом зависит от первоначальной концентрации препарата. Все рекомендации указаны в инструкции по применению. Обрабатывать пораженную слизистую нужно 2-3 раза в день после чистки зубов. Процедура проводится 1 минуту. После полоскания зубов «Хлоргексидином» не рекомендуется пить и потреблять пищу на протяжении 30 минут.

Порядок применения препарата

Для лечения стоматита у взрослого человека можно использовать Хлоргексидин, выпущенный в следующих лекарственных формах:

  • 20-процентный раствор, который необходимо разводить дистиллированной водой или спиртом. Для того чтобы приготовить средство для полосканий при стоматите, следует растворить 2,5 мл препарата в литре воды.
  • Готовый к применению 0,05-процентный раствор.

Лечение стоматита Хлоргексидином нужно проводить по следующей схеме:

  1. Тщательно почистить зубы и ополоснуть ротовую полость обычной водой.
  2. Набрать в рот немного раствора и полоскать ним слизистые оболочки не менее минуты.
  3. Сплюнуть лекарство.
  4. Отказаться от пищи на 2,5 часа.
  5. Повторить процедуру еще 2 раза в течение суток.

Применяя раствор Хлоргексидина при стоматите, очень важно следить за тем, чтобы лекарственное средство не попало в пищеварительный тракт. Случайное проглатывание препарата может повлечь за собой множество неблагоприятных последствий для организма (нарушение пищеварения, развитие аллергических реакций). Продолжительность лечения Хлоргексидином от стоматита — не более 10 дней. Нарушение этого требования может привести к активному размножению во рту микроорганизмов, относящихся к роду Candida. Изменение естественного биоценоза ротовой полости влечет за собой развитие молочницы и дисбактериоза кишечника.

При бактериальном стоматите

Сразу следует внести ясность по поводу того, при каком виде стоматита предписывают эти полоскания. Эффективными они являются при бактериальном стоматите, но когда речь заходит о вирусном стоматите герпетической природы, то назначают терапию, основанную на других действующих веществах. В редких случаях при герпетическом стоматите чередуют обработку хлоргексидином и мирамистином, если стоматолог прописывает такую схему.

При контакте с ранками слизистой, язвами, провоцируемыми стоматитом, происходит обеззараживание и уничтожение патогенных организмов. Перед лекарственным полосканием пациенту необходимо хорошо прополоскать рот тёплой водой, и только потом приступать к обработке препаратом. Орошения проводятся три раза в день, приблизительно с одинаковыми интервалами. После этого на язвы накладывают лекарственные гели.

Применение раствора после удаления зубов

Полоскание рта «Хлоргексидином» после удаления зуба проводится 0,05% раствором. Такая процедура помогает уничтожить болезнетворные микроорганизмы. Его можно применять даже при наличии большого кровяного сгустка в ране, что обеспечивает лучшее и интенсивное заживление пораженных тканей.

После удаления зуба полоскание «Хлоргексидином» проводится только после назначения стоматолога. Частое и неправильное применение лекарства может спровоцировать раздражение слизистой. Особенно осторожно нужно назначать это средство детям и во время беременности.

Предлагаем ознакомиться Как полоскать десны «Хлоргексидином»: инструкция по применению, основные рекомендации и отзывы

После удаления зуба рекомендуется совершать такую процедуру по 2-3 раза в сутки. В идеале это нужно делать утром и вечером, после потребления пищи, а также совершения всех требуемых гигиенических процедур. При полоскании категорически запрещено совершать слишком интенсивные движения, так как это может привести к вымыванию защитного кровяного сгустка. Нужно просто набрать в рот раствор, подержать 1-2 минуты и выплюнуть. Допускаются только медленные наклоны головы в стороны.

Обязательно проводится полоскание «Хлоргексидином» после удаления зуба в случае наличия кариеса, так как он повышает вероятность инфицирования пораженной области и при выявлении воспаления. Первое полоскание можно проводить не менее чем через сутки после посещения стоматолога. Оптимальная температура лекарственного средства должна составлять 40 градусов.

Инструкция по применению

Как правильно применять лекарство при стоматите можно узнать в инструкции по применению. На фармацевтическом рынке препарат выпускают в разных дозах по процентному соотношению: 0,01, 0,05, 0,1.

Важно! Для полоскания нужно применять только 0,05%-ый водный раствор. Спиртовые растворы не подходят!

Правила:

  1. Полоскать рот и горло нужно два раза в сутки, утром и вечером (после еды).
  2. Перед этим нужно обязательно почистить зубы (даже если вы только что позавтракали). Также желательно в начале прополоскать рот обычной кипяченой водой.
  3. Важно проводить процедуры достаточно долго, т.е. не 10 секунд, а как минимум 1 минуту. Нельзя пренебрегать этим правилом, так как в результате на слизистых рта формируется тонкая пленочка из вещества, которая и действует еще 2-3 часа.
  4. Врачи рекомендуют не есть еще как минимум 2 часа после полоскания.
  5. Курс лечения — от 7 до 10 дней, но не более (назначается стоматологом).
  6. Средство не нужно разводить, так как оно полностью готово к применению.

Также сейчас препарат часто назначают в виде геля, например лекарство Гексикон на основе хлоргексидина. Этим средством делают аппликации на язвочки, также 2 раза за день.

Важно! При герпетической форме стоматита препарат бессилен, так как не влияет на вирусы, в том числе простого герпеса.

У ребенка

Хлоргексидин при стоматите у детей также назначают. Маленьким детям (но не грудничкам) врач выписывает следующую схему лечения:

  • Стерильную марлю предварительно смачивают в растворе.
  • Далее аккуратно обрабатывают поверхности язывочек.
  • Проводить процедуры нужно два раза в день.

Важно! Если маленький ребенок проглотил раствор при процедуре, то требуется промывание желудка. Врач назначает в этом случае активированный уголь (две таблетки). Поэтому, при лечении малышей требуется внимательно и осторожно проводить процедуру.

Состав

Флакон 40 мл содержит:

действующее вещество: хлоргексидина биглюконат (в виде дезина (хлоргексидина биглюконата 20 % раствора)) – 20 мг;

вспомогательное вещество: вода очищенная – до 40 мл.

Флакон 80 мл содержит:

действующее вещество: хлоргексидина биглюконат (в виде дезина (хлоргексидина биглюконата 20 % раствора)) – 40 мг;

вспомогательное вещество: вода очищенная – до 80 мл.

Флакон 100 мл содержит:

действующее вещество: хлоргексидина биглюконат (в виде дезина (хлоргексидина биглюконата 20 % раствора)) – 50 мг;

вспомогательное вещество: вода очищенная – до 100 мл.

Флакон 200 мл содержит:

действующее вещество: хлоргексидина биглюконат (в виде дезина (хлоргексидина биглюконата 20 % раствора)) – 100 мг;

вспомогательное вещество: вода очищенная – до 200 мл.

Состав раствора

Ключевыми компонентами средства, активно применяемое в стоматологической практике, являются:

  • концентрация раствора 0.1% – используется для обработки и дезинфекции зубных протезов;
  • 2% хлоргексидин – не используется для очищения полости рта, а только для непосредственного контакта с корневым каналом, только опытными стоматологами;
  • концентрация 0.05% – является самой востребованной в области стоматологии: применяется для полоскания ротовой области, в очищении слизистой, в роли антисептического вещества и т.д.

Как применять хлоргексидин при стоматите

При полоскании преимущество хлоргексидина при стоматите перед другими средствами известно, т. к. он намного эффективнее очищает ротовую полость от вредоносных микробов. Однако все же ряд рекомендаций лучше соблюдать, как то:

  • Перед полосканием полости рта хлоргексидином потребуется произвести очистку рта – убрать остатки кусочков еды, используя зубные нить и щетку. Далее потребуется прополоскать рот, лучше кипяченой водой. Лишь после этих процедур можно применять хлоргексидин для полоскания.
  • В случае применения раствора концентрацией 0,05% разбавлять его ничем не требуется. Полоскать рот при этом надо около 30 секунд, воздерживаясь от глотания.

Рекомендация! Полоскание при стоматите при помощи хлоргексидина лучше осуществлять несколько раз в сутки.

Видео:

Лекарства от стоматита — ТОП-11 препаратов для лечения

Условия хранения

При соблюдении правил хранения лечебные качества препарата сохраняются на протяжении всего срока. Хранить флакон с препаратом следует в закрытом виде, в месте недоступном для детей. Запрещается подогревать средство и оставлять под прямыми лучами солнца.

Место хранения раствора должно быть тёмное, без явных посторонних запахов. Температура окружающей среды не должна быть больше 25 градусов.

Срок годности в зависимости от концентрации жидкости:

  • Раствор 0,05% хранится 2 года;
  • Раствор 20% хранится 3 года;
  • Разбавленный раствор допускается хранить и использовать до 7 дней.

При правильном использовании лечебного средства, будет достигнут лучший антисептический эффект, высыпания при стоматите уменьшатся и станут заживать. Важно знать, что безмерное использование Хлоргексидина для лечения стоматита может привести к появлению новых очагов воспаления и побочным ощущениям. Необходимо строго соблюдать медицинскую инструкцию и рекомендации лечащего врача.

Отзывы стоматологов и пациентов

Препарат переносится хорошо даже детьми и беременными женщинами. Побочные эффекты возникают крайне редко, а сообщений о случаях передозировки не имеется вовсе.

Люди, применявшие Хлоргексидин при заболеваниях зубов и десен, отмечают быстродействие препарата. Лекарство убивает патогенных микроорганизмов и возвращает здоровье полости рта. Чтобы оценить преимущества раствора, использовать его нужно в соответствии с инструкцией.

При стоматите0.05%Применяют после полного очищения ротовой полости. Раствором полощут рот в течение 30-60 секунд без остановок, 2 раза в сутки.До 10 суток
При гингивите0.05%2 раза в сутки прополоскать сразу после чистки зубов и использования зубной нити.До 10-12 дней
При воспалении дёсен0.05%Вначале больной поласкает ротовую полость отваром ромашки, либо йодо-солевым раствором. Затем, обрабатывает рот 1 ст. л. хлоргексидина. Запрещается употреблять еду в течение 2 часов после процедуры лечения. Для лечения младенцев, поражённые области смачиваются ватным диском, смоченным хлоргексидином.До 10 суток
После удаления зуба0.05%Лечение проводится через 1 час после чистки зубов, 2-3 раза в день. Раствор набирается в рот, и держится 1-2 минуты, при этом голова немного наклоняется из стороны в сторону. Движения головой не должны быть слишком резкие, во избежании травмирования защитного кровяного сгустка. Запрещается употреблять еду в течение 1 часа после лечения.Время терапии подпирается врачом индивидуально.
При зубной боли0.05%Полоскание осуществляется 3-5 раз в сутки, удерживая раствор 1-2 мин.7 дней
При пародонтозе0.05%Используется в момент снятия зубного налёта в виде ванночек. Средство должно обязательно контактировать с карманами пародонтальной ткани, и оставаться для действия на 2-3 минуты.5-7 дней
В профилактических целях0.05%Ротовая полость поласкает 20 секунд, 2 раза в день5 суток

Лекарства от стоматита: лучшие препараты Хлоргексидин, Винилин

Стоматит – воспалительное заболевание эпителиальных слизистых тканей, которые выстилаю ротовую полость. Оно является иммунным ответом организма на воздействие неблагоприятных раздражающих факторов. В основном стоматит встречается в детском возрасте, но может он беспокоить и взрослых людей.

Пузырьки локализуются на небе, щеках, языке, реже в подъязычной области. Причины их образования – снижение защитных сил организма, контакт с неблагоприятными факторами. Чтобы полностью устранить проблему, нужно подобрать правильное лечение.

Терапия должна учитывать форму заболевания и включать в себя соответствующие медикаментозные препараты.

Особенности лечения в зависимости от вида болезни

Правильно подобранная терапевтическая схема позволит устранить неприятные симптомы заболевания и вылечить стоматит до того, как он перейдет в хроническую стойкую форму. Воздействие должно быть комплексным – это местное лечение, снятие острой симптоматики, выявление и устранение причины развития заболевания.

Если не устранить причину появления стоматита, высыпания будут беспокоить вас снова и снова.

Вирусная форма

Вирусный стоматит у взрослых относится к инфекционным заболеваниям, она поражает мягкие ткани полости рта. Заболевание является реакцией ослабленного организма на негативное внешнее воздействие – вызвать его может любой вирус вроде гриппа. Если иммунная защита хорошая, проблема пройдет сама и достаточно быстро, если нет, частые рецидивы вам обеспечены.

Основное лечение вирусного стоматита состоит в местной обработке проблемных зон:

  • Оксолиновой мазью – ее можно использовать в том числе детям и беременным. Лечение длительное и эффективное, мазь наносят на пузырьки несколько раз в день.
  • Аэрозолем Тантум верде – снимает воспаление, обезболивает. Используйте каждые 3 часа до исчезновения симптомов.
  • Зовиракс – эффективное средство от герпесных высыпаний, подходит для детей старше 12 лет и взрослых. Пораженные участки смазывайте каждые 4 часа в течение недели.
  • Ацикловир-акри – аналог Зовиракса по доступной цене.
  • Холисал от стоматита – стоматологический гель противомикробного действия, обезболивает. Наносите его на десны трижды в сутки.
  • Метрогил дента – антисептик, уничтожающий микробы и бактерии. Пораженные участки смазывают 3-5 раз в день.

Дополнительно врач может назначить иммуномодуляторы (Виферон, Анаферон), снять температуру поможет Парацетамол, Нурофен.

Грибковая

Грибковая инфекция активизируется на фоне снижения иммунитета, поэтому главная цель лечения – простимулировать защитные силы организма.

Если вы принимаете иммунодепрессанты или антибиотики, возможно, их придется отменить. Другие мероприятия: Регулярно снимайте налет на слизистой, обрабатывайте ткани раствором буры, марганцовки либо пищевой соды.

Взрослым можно использовать люголь. Больше информации о грибковом стоматите читайте далее.

Нанесение противогрибковых мазей – Нистатин, Леворин, Декамин, Клотримазол.

Если местные средства не помогают, нужно принимать противогрибковые препараты перорально. Основные – Клотримазол, Нистатин, Флуконазол, Леворин. Дозировку и длительность лечения подбирает врач (иногда достаточно разового приема). Если грибковый стоматит возник у маленького ребенка, после кормления нужно обрабатывать раствором соды соски, бутылки, грудь матери.

При хронической форме грибкового стоматита назначают антигистаминные препараты и поливитамины. В качестве поддерживающей терапии можете полоскать ротовую полость отварами календулы, можжевельника, ромашки, тысячелистника. Для ускорения выздоровления исключите из рациона кисломолочные продукты, углеводы.

Бактериальная

Лечение бактериального стоматита возможно исключительно в больничных условиях. Самолечение в лучшем случае просто не поможет, в худшем усугубит ситуацию. Основные способы терапии:

  • Антибиотики – их прием показан при переходе бактериального стоматита в тяжелую форму или в том случае, если заболевание вызвано системными патологиями внутренних органов. Хорошие результаты дает лечение мазями с антибиотиком (Канацимин, Гентамицин, Линкомицин).
  • Антисептические средства – полоскания хлоргексидином, обработка слизистых противовоспалительным гелем (можно с обезболивающим эффектом). Когда основные ранки пройдут, начинайте применять эпителизирующие средства для ускорения заживления. При некрозе отмершие ткани удаляют хирургически, затем выполняют санацию ротовой полости.
  • Иммуностимуляторы общего и местного действия. Они укрепляют иммунитет, купируют воспаление.

Диета обязательна, как, впрочем, и при других формах стоматита – раздражающие продукты причиняют боль и затягивают процесс выздоровления.

Травматическая

Выбор тактики лечения в данном случае осуществляется с учетом фактора, который вызвал заболевание.

Протезы и брекеты изготавливают новые, сломанные зубы лечат и реставрируют, зубной камень убирают путем профессионального скайлинга. После устранения травмирующих факторов врач переходит к лечению стоматита.

Ранки промываются антисептиками и обрабатываются противовоспалительными препаратами. Швы накладываются при обширных повреждениях.

Дома нужно будет полоскать ротовую полость, делать аппликации и другие процедуры для ускорения выздоровления. Для полоскания обычно используется Хлоргексидин, отвары трав, местно наносятся те же мази, что при грибковой форме.

Аллергическая

Первое, что нужно будет сделать – это определить аллерген и исключить контакт с ним. Медикаменты – антигистамины (Лоратадин, Цитрин, Алерон), фолиевая кислота, витамины группы В, РР, С. Нужно провести местную обработку слизистых обезболивающими, антисептиками, ферментами, кортикостероидами, заживляющими мазями или облепиховым маслом.

Если аллергическая реакция возникла на фоне неудачного стоматологического лечения, требуется консультация профильного специалиста – стоматолога-ортопеда, терапевта или ортодонта. Пломбы, коронки, основы протезов при необходимости заменяют. Больше информации о лечении аллергического стоматита читайте далее.

Обзор лучшие препаратов

Рассмотрим самые популярные препараты, используемые для лечения стоматита.

Хлоргексидин

Антисептический раствор, используется для полосканий, удаляет бактерии и ускоряет процессы восстановления поврежденного эпителия. Он имеет вид прозрачной жидкости. Концентрация активного вещества в водном растворе может быть разной – от 0.05 до 20%.

Хлоргексидин – базовое средство для лечения не только стоматитов, но и пародонтозов, гингивитов.

Хлоргексидин от стоматита нельзя использовать при наличии аллергии на активный действующий компонент, дерматитах и ожогах высокой тяжести.

Детям грудного возраста средство также не подходит, во время беременности, лактации его используют с особой осторожностью. Применять Хлоргексидин совместно с другими антисептиками нельзя. При слишком частых полоскания поверхность эмали может покрываться коричнево-желтым трудноудаляемым налетом.

Мирамистин

Антимикробный бактерицидный раствор, который воздействует на грамположительную и грамотрицательную микрофлоры, тормозит развитие, размножение грибков, останавливает прогрессирование болезни.

Также лекарство позволяет формировать правильный иммунный ответ, укрепляет местный иммунитет, останавливает распространение инфекции, ускоряет восстановление тканей, вытягивает гной, выводит продукты жизнедеятельности микробов.

Купить Мирамистин можно в виде мази, раствора, спрея. Подробности о применении Мирамистина от стоматита смотрите в этом материале.

Используйте препарат строго местно, до 3-4 раз в сутки. Совместимость с антибиотиками хорошая, за счет приятного вкуса лечение Мирамистином маленькие дети переносят нормально. Дольше 10 дней препарат не используют.

Хлорофиллипт

Хлорофиллипт – натуральное лечебное средство с миртой и эвкалиптом. Формы выпуска – спрея, масляный, спиртовой растворы. Оттенок зеленый, насыщенный, аромат хвойный.

Хлорофиллипт эффективен в лечении ЛОР, стоматологических патологий, им можно обрабатывать незаживающие раны, поскольку активное вещество имеет выраженное антисептическое действие. Средство применяется в лечении стоматитов за счет выраженного бактерицидного действия, хорошо заживляет ткани, укрепляет иммунитет.

Используйте его для компрессов либо преорально. Детям давайте с осторожностью, остерегайтесь аллергических реакций. Больше информации о применении Хлорофиллипта от стоматита читайте тут.

Винилин

Противомикробный препарат, ускоряющий процессы регенерации пораженных патогенными организмами тканей. Его можно использовать при травматической, бактериальной и других формах стоматита. Винилин от стоматита хорошо очищает раны, регенерирует эпителий, убивает микробы. Возможны случаи индивидуальной непереносимости активных компонентов.

Лекарственное средство относится к нетоксичным, безопасно для детей и взрослых. На пораженные участки его наносят до 3 раз в день, удобнее всего делать это с помощью ватной палочки.

После процедуры не пейте и не ешьте полчаса. Если стоматит имеет инфекционную природу, обработку винилином рекомендуется проводить всем членам семьи больного.

При тяжелых формах заболевания местные обработки сочетают с комплексной антибиотикотерапией.

Синька

Тиазиновый краситель синего метилена (или как его еще называют синька при стоматите) – хорошее антибактериальное средство. Его молекулы связывают белки микробов и обезвреживают их.

Препарат эффективен при грибковых, бактериальных, герпесных формах стоматита, гнойных и воспалительных поражениях кожи. Формы выпуска – спиртовой, водный раствор, порошок.

Если есть повреждения слизистых или кожи, лучше использовать водный раствор (он не вызовет ожог слизистых). Перед нанесением синьки язвы нужно очистить от налета с помощью масла льна или облепихи. Дети лечение препаратом переносят хорошо.

Синька эффективна при острых и хронических формах стоматита, лечение не должно продолжаться более 10 дней при острой форме и 21 при хронической. Детям обрабатывают ранки до 2-4 раз в сутки, взрослым до 10.

Метронидазол

Метронидазол – антипротозойное средство с сильным антибактериальным эффектом. При стоматитах его применяют местно. Это оптимальный вариант для лечения язвенно-некротических изъязвлений Венсана.

Метронидазол чаще всего используют в комбинации с антибиотиками. Формы выпуска – таблетки и гель, простейшие патогенные организмы устраняются эффективно и в кратчайшие сроки.

Таблетированную форму препарата принимают по 500 мг дважды в сутки не более 5 дней. Дополнить лечение желательно полосканиями раствором или нанесением геля на проблемные участки.

Детям препарат редко, но назначают, самостоятельно без рекомендаций врача его использовать не следует.

Виферон

Гомогенная субстанция желтого оттенка с запахом ланолина. Главный активный компонент мази – человеческий рекомбинантный интерферон, вспомогательные – токоферол ацетат, ланолин, вазелин, персиковое масло, аскорбиновая кислота.

Средство оказывает выраженное противовирусное, иммуномодулирующее действие, регенерирует ткани, стимулирует процессы быстрого восстановления клеточных мембран. Воспалительный процесс купируется, повышается местный иммунитет. Виферон используется для лечения детей и взрослых.

Применение обезболивающих

Стоматит доставляет человеку немало неприятных ощущений, поскольку афты, язвочки вызывают болезненность, могут вскрываться, в результате чего становится трудно пить, есть, говорить. Общий дискомфорт негативно сказывается на качестве жизни пациента, поэтому для облегчения самочувствия рекомендуется принимать обезболивающие.

Детям обезболивающие при стоматите давать не только можно, но и нужно – они переносят заболевание сложнее, чем взрослые.

Обезболивающие средства могут выпускаться в форме гелей, мазей, спреев. Местная анестезия будет максимально эффективной при использовании гелевой формы.

Такое средство быстро всасывается слизистой, проникает в глубокие слои тканей и оказывает прицельное воздействие на нервные окончания. Неплохо помогают специальные леденцы, таблетки для рассасывания, аэрозоли.

Основные активные вещества данных средств – лидокаин, тримекаин, бензокаин.

Гексорал в таблетках могут использовать взрослые и дети старше 4 лет (максимальные дозировки – 4 таблетки в день для детей и 6 для взрослых), спрей Гексорал эффективно обезболивает при бактериальных стоматитах.

Мощный антибактериальный препарат – Стопангин. Взрослым и детям старше 6 лет нужно рассасывать по таблетке каждые 3 часа, дольше 5 дней лечение продолжаться не должно.

Камистад гель наносится трижды в день на пораженные участки в течение одной недели.

Больше информации касательно применения лекарств от стоматита смотрите на видео

Калицивирус кошек | Колледж ветеринарной медицины Корнельского университета

Калицивирус кошек - очень заразный вирус, вызывающий у кошек легкую или тяжелую респираторную инфекцию и заболевания полости рта. Это особенно распространено в приютах и ​​племенных колониях и часто поражает молодых кошек. Большинство кошек полностью выздоравливают после заражения калицивирусом, но редкие штаммы могут быть особенно смертельными. Вирус не представляет угрозы для человека.

Причина
Симптомы и осложнения
Анализы и диагностика
Лечение
Профилактика
Дополнительные ресурсы
Институт Бейкера и калицивирус

Что вызывает калицивирусную инфекцию?

Калицивирус кошек (FCV) принадлежит к большому семейству вирусов Caliciviridae, представители которого заражают широкий круг позвоночных животных, включая кроликов, домашний скот, рептилий, птиц и земноводных.Человеческий вирус норовирус, вызывающий кратковременное, но неприятное заболевание желудочно-кишечного тракта, также является членом семейства Caliciviridae.

Несколько штаммов FCV циркулируют у домашних и диких кошек. Вирус легко мутирует, что приводит к появлению новых штаммов, которые не могут быть полностью покрыты существующими вакцинами. Штаммы различаются по степени тяжести вызываемого ими заболевания, при этом большинство из них вызывает только легкое заболевание. Способность вируса к мутации, вероятно, объясняет, почему после 40 лет вакцинации против FCV вспышки все еще происходят часто.

В редких случаях спонтанно возникает мутантный штамм FCV, вызывающий очень серьезное заболевание с поражением нескольких органов или даже смертью, называемое вирулентным системным заболеванием, связанным с FCV, или FCV-VSD. Первая известная вспышка FCV-VSD произошла в Северной Калифорнии в 1998 году. Вспышки FCV-VSD необычны и не связаны друг с другом.

Почему и как моя кошка может заразиться?

FCV чаще всего встречается в среде с несколькими кошками. Риск заражения кошек выше в приютах, зоомагазинах и питомниках, где от 25 до 40 процентов кошек могут быть переносчиками.

Вирус распространяется через прямой контакт со слюной, слизью из носа и выделениями из глаз инфицированных кошек, а также через капли аэрозоля, которые распространяются при чихании кошек. Лабораторные тесты также обнаружили вирус в моче, кале и крови. Кошки обычно выделяют вирус в течение двух или трех недель после заражения, но некоторые кошки становятся долговременными носителями и продолжают выделять вирус в течение нескольких месяцев.

FCV - это стойкий вирус, который выживает на поверхности до месяца в определенных условиях.Люди, контактирующие с инфицированными кошками, могут непреднамеренно передать вирус новым животным. Источником инфекции также могут быть предметы, контактирующие с жидкостями организма кошки, такие как миски для еды, туалеты или постельные принадлежности.

Что происходит при заражении?

После контакта с FCV инкубационный период длится от двух до 14 дней до появления симптомов. Вирус, скорее всего, изначально поражает слизистую оболочку рта. После того, как вирус там реплицируется, он, вероятно, распространяется через кровоток в другие органы.Однако FCV преимущественно поражает слизистую оболочку рта и ткани легких. У большинства кошек развивается инфекция верхних дыхательных путей, а в более тяжелых случаях вирус попадает в легкие, где вызывает пневмонию.

Симптомы и осложнения

Симптомы кошки будут зависеть от напряжения FCV, которое она сокращает. Сначала у кошки будут симптомы, похожие на простуду, с чиханием, заложенностью носа, лихорадкой, а иногда и слюнотечением. Большое количество выделений может идти из глаз и носа.В более тяжелых случаях у кошек также могут развиться воспаления и язвы на языке и слизистой оболочке рта. Также могут возникнуть вялость, легкая хромота и отсутствие аппетита.

Эти симптомы могут сохраняться от пяти до 10 дней в легких случаях и до шести недель в более тяжелых. Во время болезни также могут возникать оппортунистические бактериальные инфекции. Кошки могут похудеть, и инфекция также может вызвать выкидыш у беременных кошек. Большинство кошек полностью выздоравливают, но у некоторых развивается хроническая форма гингивита, вызывающая толстые и воспаленные десны, из-за чего прием пищи становится болезненным.У пожилых кошек и молодых котят чаще наблюдаются более серьезные симптомы. К счастью, кошки очень редко поддаются инфекции FCV.

Кошки, у которых развивается FCV-VSD, будут иметь гораздо более серьезные симптомы, включая высокую температуру, отек головы и ног, а также язвы с корками и выпадение волос на носу, глазах, ушах и подушечках лап. Рот и уши могут стать желтоватыми из-за повреждения печени, может наблюдаться кровотечение под кожей и в желудочно-кишечном тракте. FCV-VSD является смертельным исходом для 60% кошек, у которых развивается это заболевание.

Тесты и диагностика

Как ветеринар диагностирует калицивирус?

Владельцы домашних животных должны всегда приводить свою кошку к ветеринару, если у нее наблюдаются признаки респираторного заболевания. FCV вызывает около половины респираторных инфекций, встречающихся у кошек, но кошачий альфа-герпесвирус1 (иногда называемый вирусом кошачьего ринотрахеита) является еще одной частой причиной, и иногда возникают двойные инфекции. Виды бактерий Chlamydia felis и Mycoplasma felis также вызывают респираторные заболевания и могут осложнять инфекции FCV.

Ветеринар осмотрит кошку на наличие симптомов. В большинстве случаев нет необходимости ставить точный диагноз, поскольку эти инфекции распространены и проходят при поддерживающем лечении. Однако, если инфицировано несколько кошек или кошки содержатся вместе с другими, ветеринар может взять мазки из глаз, носа или рта. Эти мазки будут отправлены в лабораторию для проверки на наличие вируса. Лаборатории также могут тестировать образцы тканей или сыворотки.

Коммерческие лаборатории обнаруживают наличие FCV двумя способами: путем выращивания вируса в клетках в чашке Петри или с помощью ПЦР с обратной транскриптазой (RT-PCR), процедуры, которая обнаруживает сегмент генетического материала, специфичный для калицивируса.Оба теста одинаково эффективны, хотя тест ОТ-ПЦР может быть более распространенным в некоторых областях, как часть панели, которая проверяет несколько организмов, вызывающих респираторные заболевания.

Результаты теста следует интерпретировать осторожно. Многие кошки, которые кажутся здоровыми, особенно те, которые недавно были приняты из приюта, зоомагазина или заводчика, будут иметь положительный результат теста на вирус из-за предыдущего контакта, поэтому положительный результат не обязательно указывает на то, что FCV является причиной проблемы. Недавняя вакцинация модифицированным живым штаммом вируса также может вызвать ложноположительный результат.Ошибочные отрицательные результаты более вероятны, если у кошки был мазок более чем через неделю после начала инфекции.

Коммерческое тестирование не позволяет отличить легкие штаммы FCV от более вирулентных штаммов, вызывающих FCV-VSD.

Уход

Какие варианты лечения кошек с калицивирусом?

В настоящее время не существует лечения, чтобы остановить вирус, но владельцы домашних животных могут предложить своей кошке поддерживающую терапию, пока ее иммунная система борется с инфекцией.Большинство кошек могут выздороветь дома, но серьезно больным кошкам может потребоваться интенсивный уход.

Держите нос и глаза кошки в чистоте и используйте вапорайзеры и физиологические капли для носа, чтобы очистить носовые проходы. Препарат, разрушающий слизь, например бромгексин, также может помочь уменьшить заложенность носа. Нестероидные противовоспалительные препараты могут снизить температуру и уменьшить боль во рту, а при необходимости для лечения оппортунистических бактериальных инфекций можно использовать антибиотики широкого спектра действия.

Кошки часто теряют аппетит и перестают есть из-за заложенности носа и язв во рту.Владельцы должны предоставлять сильно пахнущие, мягкие продукты, которые можно протирать, чтобы их было легче глотать, и слегка нагревать, чтобы усилить запах. Если кошки не ели более трех дней, им может потребоваться госпитализация для приема жидкости и внутривенного питания.

Если у кошки развивается FCV-VSD, ей следует пройти интенсивную терапию, которая может включать внутривенные вливания, антибиотики и другие виды лечения, если это необходимо.

Профилактика

Как вакцинировать моего питомца от калицивируса?

Вакцины не защищают полностью от FCV, но они могут значительно снизить тяжесть инфекции, если ваша кошка подвергнется заражению.Доступны несколько комбинированных вакцин против FCV, вируса герпеса кошек 1 типа и вируса панлейкопении кошек (причины чумы кошек), которые можно вводить назально или в виде инъекций. Вакцины, вводимые назально, содержат модифицированную живую форму вируса, тогда как вводимые вакцины могут быть модифицированными живыми вирусами или инактивированными. Кошки, которым вводят назальную вакцину, могут чихать в течение четырех-семи дней после вакцинации.

По достижении котятами возраста шести-восьми недель им следует делать вакцинацию каждые три-четыре недели, а последняя ревакцинация вводится после 16-недельного возраста.Если кошке уже больше 16 недель, введите две дозы вакцины с интервалом в три-четыре недели. Кошки должны получать ревакцинацию каждые три года, если они не находятся в среде с высоким риском и несколькими кошками; в этом случае их следует ревакцинировать ежегодно. Даже кошки, выздоровевшие от калицивирусной инфекции, должны получать бустеры, потому что они могут быть не защищены от других штаммов вируса.

Исследования показывают, что назальная форма вакцины обеспечивает более быструю защиту от вируса, что может быть полезно для сдерживания вспышек в приютах.

Доступна вакцина под названием Calicivax ™, которая включает модифицированные формы штамма FCV, вызывающего FCV-VSD, и типичный штамм FCV. Эта вакцина может предложить некоторую защиту от вспышек FCV-VSD, но поскольку вирулентные штаммы, вызывающие эти вспышки, возникают в результате различных мутаций в менее агрессивных штаммах, неизвестно, насколько эффективным Calicivax ™ будет против будущих вспышек. Calicivax ™ не входит в набор основных вакцин, рекомендуемых для всех кошек.

Как еще я могу помочь предотвратить болезнь?

Если у вас несколько кошек и одна или несколько из них проходят лечение от FCV, вам следует поместить инфицированных животных в карантин и очистить миски для еды и воды, туалетный лоток и другие предметы, которые могут быть заражены вирусом.Разбавленный раствор отбеливателя, состоящий из половины стакана отбеливателя на галлон воды, эффективен для уничтожения вируса. Чистящие растворы, содержащие фенол, такие как лизол, также эффективны, но не должны использоваться рядом с кошками, поскольку они вызывают раздражение и токсичны. Владельцы могут пожелать удалить других кошек из дома в этот период, чтобы предотвратить заражение. Через месяц вирус умрет естественным путем.

Кошки, которые становятся носителями, будут продолжать распространять вирус в домашних условиях даже после выздоровления от инфекции.Владельцам может потребоваться вернуть кошек-носителей в дом перед дезинфекцией, чтобы защитить оставшихся животных от заражения.

Каждый раз, когда вы приносите в дом новую кошку, разумно изолировать животное от других кошек в доме на одну-две недели, пока вы будете следить за признаками болезни.

Дополнительные ресурсы

Для ветеринаров Ветеринарное руководство Merck предоставляет информацию о калицивирусах и других респираторных инфекциях кошек. Американская ассоциация практикующих кошек публикует подробный информационный бюллетень своего консультативного совета.

Институт Бейкера и калицивирус

Д-р Джон С.Л. Паркер, доцент вирусологии Института здоровья животных Бейкера, работает с калицивирусом 15 лет. Он хочет знать, почему у некоторых кошек возникает кратковременное заболевание, похожее на грипп, а у других - хронический гингивит или более тяжелая форма заболевания, угрожающая жизни.

Исследовательская группа Паркера исследовала различные штаммы вируса, вызывающие вспышки FCV-VSD. Исследования, проведенные в его лаборатории, показали, что эти вирусы невозможно идентифицировать на основе их генетики, но есть заметные различия между штаммами, когда они растут в клетках в лаборатории.

Паркер также изучает более тонкие детали того, как FCV попадает внутрь кошачьих клеток, где он копирует себя, используя механизмы клетки. Вирус должен изменить форму, чтобы прикрепиться к молекуле рецептора на поверхности клетки, что позволяет ему проникнуть в нее. Понимая это взаимодействие, Паркер надеется определить «ахиллесову пяту», которая приведет к разработке более эффективных вакцин.

Эти исследования FCV не только дают нам лучшее представление об этой распространенной кошачьей инфекции, но также могут помочь в изучении подобных калицивирусов, таких как норовирус человека.

Микробиом полости рта, связанный с протезами, в здоровье и стоматите

ВВЕДЕНИЕ

Как здоровье полости рта, так и микробные обитатели полости рта, в частности, все чаще признаются за их роль в общем здоровье человека и заболеваниях (1). Установлены связи между микробными инфекциями полости рта и многочисленными системными заболеваниями (2), и предполагается, что биопленки полости рта служат резервуаром для возбудителей инфекционных заболеваний (3). Благодаря сочетанию мягких тканей и твердых поверхностей полость рта представляет собой уникальную среду для колонизации микробов.Совместные усилия ряда исследовательских групп привели к всеобъемлющему инвентаризации микроорганизмов полости рта (4–6). Помимо естественных поверхностей полости рта, микроорганизмы могут эффективно образовывать биопленки на искусственных твердых поверхностях, которые вводятся в процессе реставрации зубов. Образование биопленки на реставрационных материалах положительно коррелирует с более высокой шероховатостью поверхности и ее свободной энергией (7). Среди биопленок, заселяющих искусственные твердые поверхности, те, что образуются на зубных имплантатах, привлекли большое внимание в исследованиях.Здоровые имплантаты содержат очень разные микробиоты по сравнению с зубами (8), и в зависимости от исследования было высказано предположение, что разные виды микробов участвуют в развитии болезни вокруг имплантата (9). Напротив, бактериальные сообщества, заселяющие зубные протезы, еще одну важную искусственную поверхность, присутствующую в полости рта значительной части населения, в значительной степени еще предстоит изучить. Несмотря на то, что некоторые исследовательские группы изучали микробиоту, связанную с зубными протезами (10–17), большинство исследований сосредоточено на особых аспектах, включая определенные группы бактерий или влияние чистящих средств.

Более 20% людей старше 65 лет в Соединенных Штатах Америки не имеют всех зубов. С увеличением доли пожилых людей в населении эта доля, вероятно, будет расти (18, 19). Зубные протезы, заселяющие бактерии, составляют важную часть микробиома человека, которую необходимо изучить на предмет их роли в поддержании здоровья полости рта у пожилых людей. Ношение протезов связано с рядом микробных заболеваний, в том числе с воспалением слизистой оболочки зубных протезов (стоматит протезов) (20) и неприятным запахом (21).Также подозревают, что протезы служат резервуаром для респираторных патогенов (3, 13) и, таким образом, приводят к повышенному риску легочных инфекций (22). Несмотря на то, что микроорганизмы являются очевидными подозреваемыми в большинстве перечисленных заболеваний, связанных с зубными протезами, об их этиологии известно мало. Большинство исследований, посвященных изучению микроорганизмов, связанных с зубными протезами, сосредоточено на колонизации Candida sp., Который считается важным этиологическим агентом стоматита зубных протезов (23), хотя в это заболевание полости рта также причастны различные виды бактерий (11, 16, 24). ).В настоящее время доступны лишь ограниченные сведения о микробном составе биопленок, растущих на зубных протезах. Необходимо провести сравнение с микробиотой, обитающей на естественных поверхностях полости рта, чтобы выяснить, формируют ли и как микроорганизмы, колонизирующие протез, микробиоту полости рта, и наоборот. Очень немногие исследования оценивали колонизацию бактериального протеза с использованием независимой от культуры библиотеки клонов и подходов в шахматном порядке (10, 14, 15, 17). На сегодняшний день только в одном недавнем исследовании сообщалось об анализе секвенирования следующего поколения, который предоставил первоначальный анализ преимущественно на уровне класса зубных протезов, колонизирующих микробиоту, соответствующих поверхностей слизистой оболочки и выбранных оставшихся зубов (12).Хотя это важный шаг к пониманию бактериального компонента здоровья и заболеваний у пользователей зубных протезов, недавняя комплексная оценка различных участков полости рта на уровне олиготипа подчеркнула важность определения сообществ на более подробных таксономических уровнях, чтобы лучше понять экологические и функциональные аспекты. разнообразие микробиоты, имеющей отношение к здоровью и болезням (25). Этот уровень анализа все еще отсутствует для микробиоты, связанной с зубными протезами, и соответствующих микробных сообществ на оставшихся зубах владельцев зубных протезов.

В этом исследовании мы выполнили комплексный анализ микробных биопленок, заселяющих зубные протезы, на основе секвенирования гена 16S рРНК на уровне родов и видов. Сопоставленные образцы зубных протезов и оставшихся зубов здоровых людей и людей со стоматитом зубных протезов, но без других заболеваний полости рта, были использованы для сравнения факторов, связанных с пациентом и поверхностью. Мы исследовали, являются ли биопленки, присутствующие на этих разных поверхностях, разными, можно ли различить сообщества биопленок, связанных со здоровьем и заболеванием, и влияют ли микробные сообщества, присутствующие на разных поверхностях у одних и тех же пациентов, друг на друга.Выявление соответствующих факторов и микроорганизмов, связанных с заболеванием, расширит возможности стоматологов по разработке более целенаправленных подходов к лечению заболеваний, связанных с зубными протезами.

РЕЗУЛЬТАТЫ

Характеристики пациентов, сбор образцов и секвенирование. Образцы были собраны индивидуально с зубных протезов и оставшихся зубов 10 здоровых носителей зубных протезов и 10 пациентов со стоматитом зубных протезов, которые в остальном не имели микробных заболеваний полости рта (см. Материалы и методы). Детали).Мы определили таксономический состав микробиоты полости рта по 454 гипервариабельным областям от V1 до V3 16S рРНК генов 16S рРНК с помощью пиросеквенирования в общей сложности сорока образцов (один образец зубного протеза и один образец зубного протеза на пациента, собранный, как описано в разделе «Материалы и методы»). Мы получили в общей сложности 106 894 чтения со средней длиной чтения 444 п.н. после удаления низкокачественных и коротких последовательностей, а также химерных последовательностей. Один из образцов, взятых из оставшихся зубов пациента со стоматитом, который дал <1500 считываний, был исключен из дальнейшего анализа вместе с подходящим образцом зубного протеза из-за отсутствия достаточной глубины секвенирования.Для каждого образца было проанализировано в среднем 2739 считываний (диапазон от 1692 до 4975), что обеспечивает достаточную глубину секвенирования, чтобы зафиксировать общее разнообразие образцов (см. Рис. S1 в дополнительном материале).

Структуры сообщества микробиомов, связанных с зубными протезами и зубами, у здоровых и больных, носящих зубные протезы, очень похожи. Последовательности гена 16S рРНК были обработаны, как описано в разделе «Материалы и методы». Двадцать шесть различных родов, представляющих в общей сложности 136 различных видов / филотипов, присутствовали по крайней мере у двух субъектов с относительной численностью> 1% (рис.1). Равномерность и богатство микробного сообщества (альфа-разнообразие) на уровне рода были очень похожи между зубными протезами и оставшимися естественными зубами как в состоянии здоровья, так и в состоянии болезни (рис. 2А). Структура микробного сообщества (бета-разнообразие) статистически значимо не различалась между четырьмя разными группами (зубные протезы - здоровье; зубные протезы - стоматит; оставшиеся зубы - здоровье; оставшиеся зубы - стоматит), независимо от того, какой аспект исследовался (рис. 2B; см. Рис. S2 в дополнительном материале).Затем мы сравнили отдельные таксоны, присутствующие в образцах, полученных от зубных протезов и естественных зубов одного и того же человека с комбинациями зубной протез, зубной протез и зубной протез от разных людей, используя различие Брея-Кертиса, которое, в отличие от UniFrac, не учитывает филогенетическое родство между членами сообщества. Среднее совпадение филотипов в соответствующих образцах зубных протезов, полученных от одних и тех же участников исследования, было значительно выше (более низкий индекс Брея-Кертиса), чем в различных комбинациях образцов, полученных от разных людей (рис.2С). Таким образом, микробная колонизация разных поверхностей внутри человека кажется более похожей, чем одна и та же поверхность (протезы или оставшиеся зубы) у разных людей.

Рисунок S2

Бета-разнообразие (анализ основных координат) микробных сообществ, колонизирующих здоровых людей (зеленый) и пациентов со стоматитом (красный), независимо от поверхности (A) и колонизирующих зубные протезы (синий) и оставшихся зубов (черный), независимо от состояние здоровья полости рта, связанное с зубным протезом (B). Скачать Рисунок S2, файл TIF, 0.4 МБ. Авторские права © 2016 Shi et al.

Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0. .

Рис. 1

Состав на уровне рода зубных протезов и ассоциированных с зубами микробиомов при здоровье и стоматите. Относительная численность на уровне рода в образцах зубных протезов (вверху) и зубов (внизу), собранных у одних и тех же людей, показана в одном порядке (от h2 до h20, от S1 до S6 и от S8 до S10). Слева показаны образцы от здоровых людей, справа - от пациентов со стоматитом.HD, здоровый протез; SD - протез при стоматите; HT - здоровые оставшиеся зубы; ST, стоматит оставшихся зубов. Роды, присутствующие с относительной численностью> 1% по крайней мере в двух образцах пациентов, были включены в анализ и перечислены справа с соответствующей цветовой кодировкой. Роды, присутствующие при относительной численности <1% или только в одной выборке пациентов, были объединены в категорию «Прочие».

FIG 2

Анализ структуры микробного сообщества. (A) Альфа-разнообразие (индекс Шеннона) микробного сообщества между зубными протезами и зубами в состоянии здоровья и болезни, (B) Бета-разнообразие (анализ основных координат [PCoA]) микробных сообществ, колонизирующих зубные протезы (синий) или оставшихся зубов (зеленый ) здоровых людей и больных стоматитом (красные - зубные протезы; желтые - оставшиеся зубы) соответственно.(C) Совместная встречаемость филотипов (рассчитанная как несходство Брея-Кертиса) в образцах зубных протезов и оставшихся зубов от здоровых людей (черные полосы) и пациентов со стоматитом (белые полосы). Филотипы, колонизирующие зубные протезы (D) и зубы (T), сравнивались у одних и тех же людей (DT Same Ind.), Между разными людьми (DT Different Individuals) и между образцами зубных протезов (DT Different Individuals) и зубов (TT Разные люди). от разных людей. *, P <0.05; **, P <0,001.

Из 26 идентифицированных родов (см. Рис. S3A в дополнительном материале) 25 были обнаружены в зубных протезах, а 24 колонизированных зуба (см. Рис. S3B) соответствовали вышеуказанным критериям исключения. Eikenella и Abiotrophia в значительном количестве отсутствовали на оставшихся зубах, в то время как род Gemella в значительной степени отсутствовал на зубных протезах. Род Actinomyces был наиболее распространен на обеих поверхностях, зубных протезах и оставшихся зубах, за ним следовали Streptococcus , Veillonella , Capnocytophaga , Neisseria , Prevotella и Corynebacterium , все из которых были идентифицированы в более половины протестированных образцов независимо от поверхности или состояния здоровья.Другие роды, отвечающие указанным выше критериям отсечения, включали Rothia , « Candidatus TM7» (« Candidatus G-1»), Leptotrichia , Porphyromonas , Selenomonas , Campylobacter , Lautropia , Lautropia , Lautropia Granulicatella , Haemophilus , Kingella , Fusobacterium , Bacteroidales Candidatus G-5»), « Candidatus TM7» (« Candidatus G-5»), Actinobaculum Tannerella и Clostridiales Candidatus F-2», « Candidatus G-5»), а также Gemella , Eikenella и Abiotrophia .Ни одно из видимых различий в распространенности или относительной численности не было значительным.

Рисунок S3 Роды

, присутствующие в относительной численности> 1% по крайней мере в двух образцах пациентов, были включены в анализ. Показаны распространенность (a) и средняя относительная численность ± SEM (b) всех образцов (средние серые полосы) (A), дифференцированных на зубные протезы (темно-серые столбцы) и зубы (светло-серые столбцы) (B), а также в состоянии здоровья. (черные полосы) и стоматит (белые полосы) (C). *, P Рисунок S3, файл TIF, 2.5 МБ. Авторские права © 2016 Shi et al.

Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0. .

Затем мы провели аналогичный анализ, сравнивая образцы, полученные от здоровых субъектов, с образцами, полученными от пациентов со стоматитом, независимо от поверхности, с которой они были взяты (см. Рис. S3C). Микробиомы здоровых людей содержали только 22 из 26 родов, включенных в анализ. Отсутствующие роды: Fusobacterium , Tannerella , « Candidatus TM7» (« Candidatus G-5») и Eikenella .Микробные сообщества, выделенные от больных стоматитом, содержали все роды, за исключением Gemella . Единственным родом, который продемонстрировал значительные различия ( P = 0,026) в относительной численности между здоровьем и заболеванием независимо от поверхности, был Fusobacterium (см. Рис. S3C и S4A).

Рисунок S4

Состояние здоровья и болезни и поверхностно-зависимая дифференциальная колонизация на уровне рода и филотипа. Показаны средние значения относительной численности Porphyromonas sp.штамм HOT-279, P. gingivalis и другие связанные с заболеванием бактерии Porphyromonas ( P. cantoniae , P. endodontalis и Porphyromonas sp., штамм HOT-275 в сочетании) (A) и Campylobacter showae, Capnocytophaga sp. штамм HOT-329 и P. melaninogenica (B). Образцы подразделяются на состояние здоровья (черные столбцы), заболевания (белые столбцы), зубные протезы (темно-серые столбцы), зубы (светло-серые столбцы), зубные протезы в состоянии здоровья (синие столбцы), зубные протезы от пациентов со стоматитом (красные столбцы), здоровые зубы. (зеленые столбцы) и зубы больных стоматитом (желтые столбцы).*, P Рисунок S4, файл TIF, 1,3 МБ. Авторские права © 2016 Shi et al.

Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0. .

Для дополнительных сравнений мы дополнительно разделили образцы на образцы, полученные от зубных протезов и зубов здоровых людей и пациентов с зубным стоматитом (рис. 3). Микробиом зубных протезов от пациентов со стоматитом был самым разнообразным и включал 24 различных преобладающих рода, в то время как на протезах здорового человека было обнаружено только 18 родов.В каждом случае, здоровье и болезнь, оставшиеся зубы состояли из 21, хотя и не идентичного, рода. Некоторые из родов, которые встречались в меньшей степени, были преимущественно обнаружены в определенных условиях. Kingella и Gemella в основном колонизировали зубы здоровых носителей протезов, тогда как Bacteroidales Candidatus G-5») отсутствовали. Eikenella использовалась только для больных зубных протезов. Род Porphyromonas соответствовал пороговому значению относительной численности в 1% для всех состояний, кроме больных зубных протезов.В Fusobacterium , Tannerella и « Candidatus TM7» (« Candidatus G-5»), которые были обнаружены преимущественно у пациентов с заболеванием, не было обнаружено поверхностно-зависимых различий.

Рис. 3

Распространенность рода и средняя относительная численность микробиомов, связанных с зубными протезами и зубами, в состоянии здоровья и при стоматите. В анализ были включены роды, присутствующие с относительной численностью> 1% по крайней мере в двух образцах пациентов. Показаны распространенность (A) и средняя относительная численность ± SEM (B) на зубных протезах в состоянии здоровья (синие столбцы), на зубных протезах пациентов со стоматитом (красные столбцы), на здоровых зубах (зеленые столбцы) и на зубах у пациентов со стоматитом. (желтые полосы).Цифры, которым предшествуют буквы G и F, относятся к еще не названным родам и семействам, соответственно, в пределах указанных типов и порядков.

Определенные виды / филотипы демонстрируют отчетливую поверхностную колонизацию зубов и зубных протезов, связанную со здоровьем и заболеваниями. Дополнительный подробный анализ уровня филотипов видов / был проведен для родов, которые встречались по крайней мере в 10% образцов, чтобы исключить влияние филотипы, которые встречаются только в одном или двух образцах с очень высокой относительной численностью и, следовательно, не являются репрезентативными для данного состояния.Этот анализ показал, что Fusobacterium nucleatum subsp. animalis был обнаружен почти исключительно на зубных протезах пациентов со стоматитом ( P = 0,016). F. nucleatum subsp. vincentii , напротив, был обнаружен в основном на оставшихся зубах пациентов со стоматитом ( P = 0,0097) (рис. 4A), тогда как F. nucleatum subsp. polymorphum и F. periodonticum существенно не различались ни на поверхности, ни по состоянию здоровья или болезни (данные не показаны).Несмотря на то, что Streptococcus не выделялись как род, несколько видов, включая Streptococcus gordonii ( P = 0,012), S. sanguinis ( P = 0,049) и S. australis ( P = 0,0215). ), колонизировали зубные протезы здоровых носителей зубных протезов на значительно более высоком уровне (рис. 4B). Интересно, что Porphyromonas sp. штамм HOT-279, филотип рода, часто ассоциируемый с заболеваниями полости рта (26), был значительно более распространен здоровьем ( P = 0.048) (см. Рис. S4A). Большинство других представителей этого рода были прочно связаны с зубами у больных стоматитом, хотя и в относительно небольшом количестве. Поверхностно-зависимые различия независимо от состояния здоровья / заболевания наблюдались для Campylobacter showae ( P = 0,0173), Capnocytophaga sp. штамм HOT-329 ( P = 0,045) и P. melaninogenica ( P = 0,026), причем первые два присутствуют преимущественно на зубах, а последний значительно больше на поверхностях протезов (см.рис.S4B).

FIG 4

Дифференциальная колонизация зубных протезов или зубов при здоровье и болезни на уровне рода и филотипа. Показана средняя относительная численность рода Fusobacterium , а также F. nucleatum subsp. animalis и vincentii (A), S. gordonii, S. sanguinis и S. australis (B). Образцы подразделяются на состояние здоровья (черные столбцы), заболевания (белые столбцы), зубные протезы в состоянии здоровья (синие столбцы), зубные протезы от пациентов со стоматитом (красные столбцы), здоровые зубы (зеленые столбцы) и зубы от пациентов со стоматитом (желтые столбцы). .*, P <0,05.

Кроме того, каждый образец зубного протеза оценивали на наличие Candida с помощью ПЦР. В группе пациентов со стоматитом Candida был обнаружен в 90% образцов по сравнению с 50% образцов из здоровой группы (Таблица 1). Несколько видов бактерий, включая Atopobium parvulum, Lachnospiraceae sp. штамм HOT-097 и Veillonella atypica присутствовали в основном в образцах протезов, содержащих Candida , а Leptotrichia sp.штамм HOT-212, за исключением одного пациента, присутствовал только в образцах без Candida .

ТАБЛИЦА 1

Оценка образцов зубных протезов на наличие Candida с помощью ПЦР и совместной встречаемости с видами / филотипами бактерий

ОБСУЖДЕНИЕ

Стоматит зубного протеза в значительной степени изучался в контексте грибковых инфекций, и даже несмотря на то, что имел место Сделанное несколько десятилетий назад предложение Купманса и его коллег «уделять больше внимания бактериальной популяции при стоматите, вызванном зубными протезами, вместо того, чтобы сосредоточиться только на Candida albicans» (11), с тех пор этого было сделано мало.Подробный анализ библиотеки клонов (10) дал первое представление о разнообразии бактериальных филотипов, связанных с зубными протезами в состоянии здоровья и болезни, в то время как недавнее исследование преимущественно на уровне классов и типов (12) представило современные подходы к секвенированию в этой области. Представленные здесь данные представляют собой первый комплексный анализ на уровне родов и видов бактерий, обитающих в биопленках на зубных протезах и оставшихся зубах здоровых пациентов и пациентов со стоматитом. Важно отметить, что сравнение образцов, взятых из зубных протезов и оставшихся зубов одних и тех же людей, позволило нам проанализировать возможное взаимное влияние бактериальных сообществ, колонизирующих эти различные поверхности, в состоянии здоровья и болезни.

Наш первоначальный анализ на уровне родов показал, что, в отличие от отдельной микробиоты, связанной со здоровьем и заболеванием, о которой ранее сообщалось для других заболеваний полости рта, таких как пародонтит (27–30), бактериальные сообщества, проживающие на зубных протезах и оставшихся зубах в состоянии здоровья и болезни, скорее похожи друг на друга (рис. 1). Отсутствие различий в составе бактериального сообщества также отражалось в соответствующем альфа- и бета-разнообразии (рис. 2A и B; см. Рис. S2). В соответствии с предыдущими данными о больших индивидуально зависимых вариациях микробиома (29, 31, 32), мы обнаружили, что филотипический состав бактериальных сообществ, растущих на зубных протезах, и сообществ, полученных из оставшихся зубов, были значительно более похожи друг на друга (нижняя часть Брея-Кертиса индекс несходства) в образцах, полученных от одного и того же человека, чем в несвязанных зубных протезах и образцах зубов от разных людей (рис.2С). Это также отражено в нашем наблюдении, что только три филотипа видов / продемонстрировали значительную дифференциальную колонизацию поверхности (см. Рис. S4B). Учитывая это очевидное сильное взаимное влияние бактерий, колонизирующих зубные протезы и зубы у одного и того же человека, здоровье и целостность оставшихся зубов могут быть важным фактором здоровья слизистой оболочки носителей зубных протезов, помимо их роли в закреплении реставраций и поддержании целостности кости. Точно так же состояние слизистой оболочки полости рта, связанное с протезом, может сыграть решающую роль в сохранении оставшихся зубов.

Кроме того, составы бактериальных филотипов, присутствующие в биопленках, собранных с одной и той же поверхности (зубные протезы или оставшиеся зубы) разных пациентов, были значительно менее похожи друг на друга, чем на сообщества, идентифицированные на сопоставленных образцах зубных протезов у ​​тех же пациентов (рис. . 2С). Это интересно, поскольку считается, что образование биопленок в значительной степени зависит от поверхности (7), и, хотя существует перекрытие, различные естественные поверхности в полости рта заселяются разными сообществами (25).Наши результаты показывают, что индивидуальные факторы могут быть более доминирующими детерминантами состава бактериальной биопленки полости рта, чем поверхности. Одним из важных факторов, влияющих на это явление, может быть слюна, которая покрывает доступные естественные, а также искусственные поверхности полости рта так называемой пленкой (33). Слюна может иметь большие различия между людьми (34, 35) и обеспечивает важные адгезионные белки для прикрепления бактерий (36). Кроме того, наше открытие о том, что факторы, возникающие внутри пациента, могут быть более сильными детерминантами состава сообщества бактериальной биопленки, чем различные поверхности, подчеркивает, что группировка и объединение образцов от разных людей может влиять на результат анализа.

Предыдущие исследования, посвященные анализу бактерий, колонизирующих зубные протезы при здоровье и болезнях, не являются окончательными. Подобно нашим результатам, недавнее исследование секвенирования (12) и более старые подходы, основанные на культуре (11, 16, 24), не обнаружили различий в видимом микробном составе между здоровыми пациентами и пациентами со стоматитом и отметили только то, что количество накопленных бляшек значительно больше у больных стоматитом. Напротив, независимое от культуры исследование на основе библиотеки клонов (10) показало, что микробиота биопленок, колонизирующих зубные протезы, при здоровье и болезни различна.Кроме того, в отличие от наших результатов, подробно описанных выше, недавно опубликованное исследование секвенирования (12) описало значительную разницу между составами бактериального сообщества, обнаруженными на поверхности зубных протезов, и на оставшихся зубах. Очевидные расхождения между нашими результатами и предыдущими исследованиями секвенирования на основе гена 16S рРНК могут быть вызваны многими факторами, начиная от географических различий между популяциями пациентов и заканчивая сбором образцов, параметрами секвенирования (выбор целевой области 16S рРНК, используемая платформа секвенирования, доступно для чтения длина и глубина секвенирования, среди прочего) или протоколы экстракции ДНК и ПЦР (37).

Неудивительно, что мы обнаружили, что Actinomyces , Capnocytophaga , Streptococcus , Veillonella и Neisseria являются наиболее распространенными и многочисленными родами, независимо от поверхности или состояния здоровья / болезни, во всех наших образцах. (Рис. 3; см. Рис. S3). Эти роды являются одними из наиболее распространенных в полости рта и были идентифицированы как основные колонизаторы зубных протезов в предыдущих исследованиях, основанных на культуре и не зависящих от культуры (10–12, 16).В частности, роды Actinomyces и Streptococcus считаются ранними колонизаторами ротовой полости, которые легко прикрепляются к доступным поверхностям, а также друг к другу (38, 39). Они делают возможным поверхностную колонизацию других видов микробов, включая Capnocytophaga и Neisseria , посредством физического связывания, а также метаболических взаимодействий, таких как метаболическая взаимозависимость между видами Veillonella и Streptococcus (40, 41).Другие распространенные роды, присутствующие в образцах, проанализированных в нашем исследовании, включают Corynebacterium , Rothia , несколько родов « Candidatus TM7» и Fusobacterium . Большинство предыдущих исследований, сравнивающих зубной налет в состоянии здоровья и болезни, не идентифицировали эти роды (10–12), хотя в исследовании с шахматной доской, сравнивающем модели колонизации естественных зубов и зубных протезов, было обнаружено, что они колонизируют зубные протезы (15). В соответствии с более ранними исследованиями (10, 12, 23, 24, 42, 43), образец Candida не ограничивался образцами стоматита зубных протезов, при этом меньшее количество образцов здоровых пациентов было положительным (Таблица 1).В то время как предыдущий анализ на уровне классов показал, что колонизация Candida положительно коррелировала с лактобактериями и отрицательно коррелировала с Fusobacteria , это не имело место для проанализированных здесь образцов. В нашем исследовании мы наблюдали возможную положительную корреляцию для A. parvulum , Lachnospiraceae sp. штамм HOT-097 (« Candidatus G-4»), Veillonella atypica, а Leptotrichia sp. штамм HOT-212 не присутствовал в образцах, содержащих Candida , за исключением одного здорового пациента.Поскольку мало что известно о взаимодействии между этими видами и Candida , необходимы дальнейшие исследования, чтобы подтвердить актуальность этого наблюдения.

Несмотря на сходство на уровне сообщества биопленок, отдельные роды и виды значительно различались по своему присутствию на определенных поверхностях и / или по состоянию здоровья / болезни пациента, связанному с зубными протезами. Все представители рода Fusobacterium имели очень низкие показатели колонизации здоровых зубных протезов и здоровья в целом (рис.4A), даже несмотря на то, что виды Streptococcus gordonii и S. sanguinis, к которым, как известно, прикрепляются фузобактерии (44, 45), присутствовали в значительно повышенном количестве в этом состоянии (рис. 4B). Эти данные показывают, что в сложной биопленочной среде полости рта факторы, помимо способности связываться друг с другом, играют важную роль в динамике и составе микробного сообщества. Среди различных видов и подвидов Fusobacterium F. nucleatum subsp. polymorphum , F.нуклеатум подвид. Ранее наблюдалось, что vincentii и F. periodonticum увеличиваются больше на естественных зубах, чем на зубных протезах (15). В нашем исследовании они показали более высокое относительное количество на естественных зубах при заболевании; однако это различие было значимым только для F. nucleatum subsp. vincentii (рис. 4А). Удивительно, но характер колонизации F. nucleatum subsp. animalis полностью отличался от такового у всех других идентифицированных видов и подвидов фузобактерий, с поразительной почти исключительной колонизацией поверхностей зубных протезов у ​​пациентов со стоматитом (рис.4А). Этот конкретный подвид F. nucleatum был идентифицирован как этиологический агент в отчете о случае, связывающем микробиоту полости рта с мертворождением (46), документально подтверждено, что он более распространен при поддесневом налете и раннем периодонтите (47), а также экспериментальном гингивите (48). ). Кроме того, F. nucleatum subsp. animalis является частью микробной сигнатуры при раннем обнаружении колоректального рака (49) и единственным подвидом фузобактерий /, который, как было обнаружено, перекрывается между микроорганизмами, выделенными из пародонтального кармана, и атероматозной бляшкой у пациентов с сердечными заболеваниями (50).Наше открытие сильной ассоциации F. nucleatum subsp. animalis с воспалительным заболеванием слизистой оболочки стоматитом в сочетании с вышеупомянутыми результатами других исследовательских групп предполагает, что этот подвид F. nucleatum может быть более патогенным, чем другие.

Помимо заметных различий между F. nucleatum subsp. животных и , что может иметь отношение к этиологии стоматита, другие микроорганизмы демонстрировали несопоставимые модели колонизации, зависящие от поверхности и / или состояния здоровья.Как уже упоминалось выше, определенные виды Streptococcus показали значительно более высокую распространенность и численность на зубных протезах у здоровых пользователей зубных протезов, чем при всех других условиях (рис. 4B). Среди них S. sanguinis и S. gordonii ранее были связаны со здоровьем полости рта (51–53), а недавнее исследование выявило отчетливое видоспецифичное распределение стрептококков на естественных поверхностях полости рта здоровых людей (25). Дополнительное свидетельство важности анализа, выходящего за пределы уровня рода или типа, обеспечивает картину колонизации родов Fusobacterium и Porphyromonas .В то время как их присутствие сильно коррелировало со здоровьем и болезнью независимо от поверхности при анализе на уровне рода (рис. 4A; см. Рис. S4A), подробный анализ на уровне филотипов видов / дал более дифференцированную картину. Как уже обсуждалось выше, различные представители рода Fusobacterium , присутствующие в наших образцах, демонстрировали отчетливое распределение в зависимости от состояния поверхности и состояния зубных протезов (рис. 4A). Наше открытие, что Porphyromonas , род, обычно связанный с заболеванием (26), демонстрирует значительную независимую от поверхности ассоциацию со здоровьем (см.рис.S4A) представляет собой пример того, как отсутствие таксономического разрешения может повлиять на результаты и интерпретацию данных. Исследование на уровне филотипа показало, что род Porphyromonas преимущественно представлен в наших выборках Porphyromonas sp. штамм HOT-279, филотип, который в изобилии встречается у здоровых людей, участвовавших в проекте Human Microbiome Project (25, 54). Дополнительные, менее многочисленные представители Porphyromonas (P. gingivalis, P.endodontalis , P. catoniae и Porphyromonas sp. штамм HOT-275) продемонстрировали «типичную» ассоциацию с заболеванием этого рода, поскольку они достоверно коррелировали с остальными зубными рядами пациентов со стоматитом (см. рис. S4A). Поскольку эти отчетливые паттерны распределения отдельных представителей определенных родов, связанные со здоровьем и болезнями, очевидны только на уровне филотипа / вида, анализа микробиома на уровне рода не всегда достаточно для получения исчерпывающей картины соответствующих игроков, и анализ с более высоким разрешением иметь решающее значение для глубокого понимания микробиома полости рта в отношении здоровья и болезней.

В заключение, наше исследование предполагает, что бактериальная микробиота на зубных протезах очень похожа по здоровью и болезням на более широком уровне сообщества. Это также наблюдалось в отношении зубных протезов и оставшихся зубов независимо от состояния здоровья, особенно в образцах, взятых у одних и тех же людей. Филотипический состав бактериальных сообществ, заселяющих зубные протезы и оставшихся зубов одних и тех же людей, в значительной степени отражает друг друга, что указывает на возможное взаимное влияние состояния здоровья зубных протезов на зубной ряд и наоборот.Наблюдаемое отсутствие четкой микробиоты согласуется с большинством предыдущих отчетов о том, что при заболеваниях полости рта, связанных с зубными протезами, общая микробная нагрузка может иметь большее влияние на развитие стоматита, чем фактический микробный состав зубного налета, обращенного к слизистой оболочке. Несмотря на это общее сходство, мы смогли идентифицировать отдельные виды, такие как F. nucleatum subsp. animalis и несколько видов Streptococcus , которые были сильно связаны с образцами больных и здоровых протезов, соответственно.Наши данные о том, что значительные различия в колонизации наблюдались преимущественно на уровне филотипа / видов, подчеркивают важность анализа на уровне видов / филотипов или даже олиготипов (25).

МАТЕРИАЛЫ И МЕТОДЫ

Популяция испытуемых и сбор образцов. Двадцать взрослых добровольцев, носящих зубные протезы, с минимум четырьмя оставшимися зубами и одним полным зубным протезом были набраны для этого исследования под контролем Институционального наблюдательного совета No. 2012-0004 гг. - в Западно-Китайский университет (Чэнду, Китай).Согласно опубликованным рекомендациям по диагностике стоматита зубных протезов, десять человек были здоровыми носителями зубных протезов и 10 были пациентами со стоматитом, связанным с зубными протезами (55). В группу здоровых носителей зубных протезов вошли пять женщин и пять мужчин, средний возраст 69,8 ± 4,7 года. Аналогичным образом в группу больных стоматитом вошли пять женщин и пять мужчин со средним возрастом 61,1 ± 12,0 года. У участников исследования не было других активных заболеваний полости рта, таких как кариес или пародонтит.Подходящие люди были системно здоровыми и не принимали никаких рецептурных или безрецептурных лекарств в течение как минимум 6 месяцев. Кроме того, участники исследования в течение последних 6 месяцев не использовали никаких биоцидных зубных паст или очистителей для зубных протезов. Информированное согласие было получено до сбора образцов и подписано участниками исследования, а также клиницистами и исследовательским персоналом, выполняющими оценку состояния полости рта, сбор и обработку образцов.

Участников исследования попросили носить зубные протезы не менее 3 часов и воздерживаться от еды, питья и чистки зубов или зубных протезов перед взятием образцов налета.Образцы зубного налета были собраны обученным стоматологом с частей розовой акриловой поверхности протеза, которые контактировали с поверхностью слизистой оболочки полости рта, путем наложения стерильных зубочисток круговыми движениями. С помощью аналогичных круговых движений стерильные зубочистки также использовались для получения наддесневого налета с оставшихся зубов. Были приняты меры для сбора с щечных поверхностей зубов, которые не имели прямого контакта с поверхностями протезов. Отдельные образцы зубных протезов и зубного налета, а также контрольные зубочистки помещали в отдельные микроцентрифужные пробирки, содержащие 0.5 мл фосфатно-восстановленного физиологического раствора с пониженным содержанием кислорода и немедленно хранить при -20 ° C до экстракции ДНК.

Экстракция

ДНК и секвенирование. Геномную ДНК выделяли из собранных образцов бляшек и соответствующих контролей из стерильных зубочисток с помощью набора DNeasy Blood and Tissue (Qiagen Inc., США), как описано ранее (56), с добавлением взбивания шариков для максимальный лизис клеток (29). Качество и количество ДНК определяли на спектрофотометре NanoDrop 2000 (Thermo, США).После выделения геномной ДНК и количественного определения концентрации ДНК в образцах были нормализованы до 2-6 нг / мкл, и амплификация ПЦР была проведена в соответствии с протоколом, разработанным Human Microbiome Project для секвенирования на титановой платформе 454 FLX (54). Вкратце, гипервариабельные области от V1 до V3 генов 16S рРНК были амплифицированы из очищенной геномной ДНК с праймерами 27F (праймер V1, 5'AGAGTTTGATCCTGGCTCAG3 ') и 534R (праймер V3, 5'ATTACCGCGGCTGCTGG3') с индивидуальной последовательностью адаптера. (5'CCATCTCATCCCTGCGTGTCTCCGACTCAG3 ') для праймера 534R и адаптера B (5'CCTATCCCCTGTGTGCCTTGGCAGTCTCAG3') для праймера 27F и объединены для секвенирования.Библиотеки ампликонов гена 16S рРНК были сконструированы, и 454 пиросеквенирование было выполнено в Объединенном технологическом центре института Дж. Крейга Вентера.

Анализ таксономического состава микробов. 454 данные пиросеквенирования были демультиплексированы в соответствующие образцы на основе индивидуальных штрих-кодов каждого образца. После того, как штрих-коды были обрезаны, процесс очистки данных был применен ко всем образцам с помощью собственной программы Perl. Вкратце, низкокачественные последовательности, содержащие основания со значением качества Phred <20, были обрезаны с концов считывания.Удаляли последовательности с конечной длиной считывания <300 п.н. или с ≥3% неопределенных оснований. Подозреваемые химеры были идентифицированы и удалены с помощью ChimeraSlayer (57). Последовательности 16S рРНК были сгруппированы в операционные таксономические единицы (OTU) на 97% уровне сходства последовательностей с QIIME (58). Затем OTU были аннотированы с таксономическим назначением путем сравнения репрезентативной последовательности каждой OTU со ссылками на базу данных оральных микробов человека (16S рРНК, RefSeq версии 11.0) (59) с помощью BLAST на основе наилучшего совпадения при> 97% идентичности нуклеотидной последовательности более не менее 95% длины запроса (56).Равномерность и богатство микробного сообщества измеряли по альфа-разнообразию, а сходство между отдельными микробными сообществами измеряли по бета-разнообразию. Альфа-разнообразие (индекс Шеннона), бета-разнообразие (взвешенный и невзвешенный UniFrac), анализ главных координат и оценка глубины секвенирования с помощью анализа разрежения были рассчитаны или выполнены с помощью QIIME (58) на уровне OTU. Роды, присутствующие по крайней мере у двух субъектов с относительной численностью> 1%, были включены в дальнейший анализ уровня филотипа родов и видов /.Таксономический состав каждой выборки был обобщен на уровне родов и видов.

Обнаружение Candida с помощью ПЦР. Наличие или отсутствие Candida в образцах, взятых с зубных протезов, оценивали с помощью универсальных праймеров ITS1 (5 'CTTGTTATTTAGAGGAAGTAA 3') и ITS2 (5 'GCTGCGTTCTTCATCATGC 3') (60) под следующие условия цикла: 94 ° C в течение 11 минут, затем 35 циклов 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд и 72 ° C в течение 30 секунд с последним 30-минутным продлением при 72 ° C.

Статистический анализ. Данные представлены как среднее ± стандартная ошибка среднего (SEM), если не указано иное. Перед анализом все наборы данных были исследованы на предмет их свойств распределения с помощью теста Шапиро-Уилка. Статистическая проверка различий в относительной численности распределения родов и видов между различными группами выборки была проверена с помощью U-критерия Манна-Уитни для попарных сравнений (протезы против зубов; здоровье против стоматита) и теста Краскела-Уоллиса для сравнения нескольких групп ( зубные протезы против зубов в здоровье и болезни).Различия в распространенности родов и филотипов между несколькими группами оценивали с помощью точного критерия Фишера. Несходство Брея-Кертиса было использовано для оценки совпадения бактериальных филотипов на зубных протезах и зубах, полученных от одних и тех же людей, по сравнению с зубными протезами и зубами от разных людей и только зубными протезами или только зубами от разных людей. Результаты несходства Брея-Кертиса были дополнительно проанализированы с помощью двустороннего непарного теста t и дисперсионного анализа.Вся статистика была проведена с соответствующими функциями в R Studio, Prism и Excel, в то время как непараметрический многомерный анализ anosim в mothur (61) использовался для проверки того, является ли сходство микробиома в группах статистически значимым от сходства между группами. Значения P были скорректированы для многократного тестирования микробных таксонов с p.adjust в R с использованием коэффициента ложного обнаружения (62).

Доступность данных. Набор данных, подтверждающих выводы этой статьи, доступен в NCBI BioProject под инвентарным номером PRJNA292354 .

Случай патологии полости рта: Проявления поражения полости рта, в которых вы можете обвинить COVID-19

© motortion | Dreamstime.com

Описание случая и клиническая оценка

Относительно здоровый 62-летний мужчина обратился с основной жалобой на «большую язву на нёбе [его] рта». Рисунок 1: Поражение ротовой полости у пациента, приехавшего из другого города, он первоначально связался со своим хирургом-стоматологом в Сан-Диего с вопросом, что ему делать. Был вызван сценарий амоксициллина 500 («на всякий случай, если он бактериальный») с дальнейшими инструкциями для проведения клинической оценки у местного стоматолога, если поражение не улучшится или окажется, что он не является бактериальным.Через пять дней изменений не было. Пациент рассказал, что поражение и область в целом очень чувствительны к кислой пище и в целом болезненны при еде и выполнении повседневных функций. Интересно, что он также поделился, что на своей работе он испытывал высокий уровень стресса из-за поездок в связи с COVID-19 и его влияния на вещи, которые были вне его контроля.

Клинический осмотр выявил большое поражение размером 12x9 мм на правой стороне соединения твердого и мягкого неба.У него был белый центр, окруженный эритематозной границей, наиболее заметно продвигавшейся в орально-фарианговом направлении (рис. 1).

Дифференциалы

Дифференциальные признаки включают: травмы, афтозный большой стоматит, аутоиммунные заболевания, вирусные заболевания, недостаточность питания

Окончательный: афтозный мажорный стоматит, вторая по распространенности форма рецидивирующего афтозного стоматита (РАС)

Таблица 1: Справочная информация для незначительные РАС, большие РАС и герпетиформные поражения РАС. (2)

RAS, также известное как язва, является наиболее распространенным заболеванием полости рта, поражающим мягкие ткани слизистой оболочки, которым страдает 15-20% населения во всем мире. 1 Эти состояния принимают три различных клинических формы - малые афтозные, большие афтозные и герпетиформные язвы.

Причина

Большинство пациентов с РАС здоровы, однако пациенты с системными заболеваниями или ослабленной иммунной системой более восприимчивы, особенно пациенты с синдромом Беше и хроническими желудочно-кишечными нарушениями всасывания (болезнь Крона и целиакия), которые вызывают дефицит фолиевой кислоты в питательных веществах. кислота, витамин B12 и железо. 1 Кроме того, была обнаружена корреляция с менструальным циклом, периодами стресса / беспокойства и семейным анамнезом. 1 В этом конкретном случае пациент сообщил, что в последнее время находился в состоянии сильного стресса из-за опасений COVID-19, связанных с работой и посторонним влиянием.

Лечение

Первоначально рекомендуется лечить первопричину. Этому пациенту и другим подобным случаям рекомендуется уменьшить стресс и системные нарушения.Нет сомнений в том, что нынешняя пандемия и вездесущее беспокойство оказали влияние на общее состояние здоровья, благополучие и психическую стабильность многих людей.

Помимо оценки основной причины, в остальном лечение является поддерживающим и паллиативным с местными методами лечения и Табл. 2: Медикаментозные методы лечения. (2) методы системного лекарственного применения. Местное лечение полезно для предотвращения суперинфекций и снижения последующего риска вторичных бактериальных инфекций. 2 Ополаскиватель с хлоргексидином 0,2% помогает устранить трамвайные положительные / отрицательные бактерии и грибки, а также предотвращает образование биопленок. 2

Этому пациенту прописали волшебный эликсир для полоскания рта, состоящий из одной части вязкого 2% лидокаина, одной части маалокса и одной части дифенгидрамина 12,5 мг / 5 мл. Последующее наблюдение через несколько недель по телефону было положительным, и пациент чувствовал себя намного лучше. Он также сообщил, что уровень его стресса снизился.


Примечание редактора: Эта статья впервые появилась в информационном бюллетене Through the Loupes , издании Endeavour Business Media Dental Group.Прочтите больше статей по этой ссылке и подпишитесь здесь.


Каталожные номера

  1. Sapp JP, Eversold LR, Wysocki GP. Современная патология полости рта и челюстно-лицевой области . Мосби; 1997: 245-249.
  2. Эдгар Н.Р., Салех Д., Миллер РА. Рецидивирующий афтозный стоматит: обзор. Журнал клинической и эстетической дерматологии . 2017; 10 (5): 26-36.

Стейси Л. Гивиден, доктор медицинских наук, , выпускница стоматологической школы университета Маркетт, занимается частной практикой в ​​Гамильтоне, штат Монтана.Она является приглашенным лектором в Университете Монтаны на кафедре анатомии и физиологии. Доктор Гивиден является соруководителем редакции Through the Loupes и соавтором статей DentistryIQ , Perio-Implant Advisory и Dental Economics. Она входит в состав редакционного совета Dental Economics . Вы можете связаться с ней по адресу [email protected]

Контурная дерматология Афтозный стоматит | Контурная дерматология

Афтозный стоматит или язвенная болезнь - распространенное доброкачественное изъязвление слизистых оболочек во рту.Эти поражения могут быть довольно болезненными, но обычно проходят без лечения за 1-2 недели. Язвы обычно начинают появляться в детстве или подростковом возрасте и могут повторяться в течение нескольких лет, прежде чем полностью исчезнут.

В большинстве случаев единственными симптомами являются появление язвы во рту и связанная с ней боль, но в тяжелых случаях этот дискомфорт может мешать нормальному питанию и вызывать непреднамеренную потерю веса и образование рубцов. Это усугубляется острой / кислой пищей и напитками.

Механизм образования этих поражений не совсем понятен, но считается, что на него влияет ряд факторов . Известно, что иммунная система почти всегда задействована, однако это обычно не считается аутоиммунным заболеванием, поскольку у него отсутствуют определенные характеристики, общие для таких состояний, такие как связь с другими аутоиммунными заболеваниями. Однако это связано с определенными системными состояниями, включая болезнь Бехчета, целиакию, циклическую нейтропению, недостаточность питания, дефицит IgA, состояния с ослабленным иммунитетом (ВИЧ / СПИД), воспалительное заболевание кишечника, синдром MAGIC, синдром PFAPA, реактивный артрит, синдром сладкого, и ulcus vulvae acutum.

У курильщиков сигарет меньше шансов заболеть афтозным стоматитом. Считается, что это происходит из-за повышенного кератинизации, вызванного сигаретным дымом, поэтому считается, что толщина слизистой оболочки играет роль в риске развития этого состояния у человека. Наконец, было высказано предположение, что язвы могут быть гиперчувствительностью или аллергической реакцией на неизвестные триггеры. Важно отметить, что эти поражения не являются инфекционными, передающимися половым путем и не являются маркером злокачественных опухолей.

Существует три основных классификации афтозного стоматита:

Незначительные афтозные язвы составляют подавляющее большинство случаев. Эти язвы небольшие (менее 10 миллиметров) и проходят без лечения и рубцевания в течение 1-2 недель.

Крупные афтозные язвы больше (более 10 миллиметров), глубже и заживают гораздо дольше - обычно около 20-30 дней. Эти язвы могут оставлять шрамы после заживления, а связанная с ними боль может мешать комфортному питанию и питью.

Герпетиформные язвы напоминают язвы герпеса, но не вызваны вирусом простого герпеса. Они очень маленькие (менее 1 миллиметра), но обычно появляются в большом количестве, и отдельные язвы могут объединяться, образуя сплошные участки изъязвления. Эта форма имеет тенденцию повторяться быстрее, чем другие формы, но обычно заживает в течение 15 дней без образования рубцов.

Лечение афтозного стоматита почти всегда не является ни необходимым, ни излечивающим - большая часть лечения направлена ​​на облегчение боли и воспаления, поскольку поражения проходят самостоятельно.Местные анестетики могут использоваться для уменьшения боли, местные антисептики могут способствовать заживлению, и местные стероиды могут уменьшать воспаление. В более тяжелых случаях можно использовать пероральные формы тех же лекарств. Гигиена полости рта важна для предотвращения инфицирования поражений. Обратитесь к дерматологу, если вы страдаете от некоторых симптомов афтозного стоматита для обследования и лечения.

* Результаты и ваш опыт пациента могут отличаться

Стоматит Винсента - обзор

Бактериальный

Острый язвенно-некротический гингивит

Острый язвенно-некротический гингивит (ANUG) характеризуется болезненным изъязвлением десны между зубами (межзубными сосочками) (Рисунок 27.3), выраженная склонность к кровоточивости десен и галитозу. К числу предрасполагающих факторов относятся анаэробные веретенообразные бактерии и спирохеты, в том числе:

плохая гигиена полости рта

курение

недоедание и иммунодефицит

другие вирусные инфекции и лейкемии.

ANUG представляет собой проблему для определенных групп населения, особенно для тех, кто сталкивается с серьезной бедностью и недоеданием.Это также влияет на пациентов с ослабленным иммунитетом. ANUG нередко следует за инфекцией дыхательных путей, предположительно предрасположенной к временному иммунному дефекту, возникающему в результате некоторых таких инфекций, особенно вирусных. ANUG все чаще встречается при вирусных инфекциях, таких как ВИЧ; у некоторых других людей с ANUG были описаны только более тонкие иммунные дефекты, такие как снижение уровня иммуноглобулина А в слюне и дисфункция нейтрофилов. Во всем мире основной причиной иммунодефицита по-прежнему является недоедание, а ANUG действительно встречается в недоедании.Однако есть пациенты, которые страдают от ANUG при отсутствии каких-либо явных иммунных дефектов, недоедания или других системных факторов, и в этих случаях факторами могут быть плохая гигиена полости рта и курение табака. Это наблюдается прежде всего в раннем детстве и у молодых людей. 34

ANUG обычно наблюдается там, где плохой контроль зубного налета. Смешанная флора, в которой преобладают фузобактерии и спирохеты, такие как видов Treponema , Bacteroides ( Porphyromonas ) melaninogenicus промежуточных видов, видов Fusobacterium , видов Selenomonas и присутствующих Borrelia vincearntii in conditionarntii резко улучшается при лечении пенициллином или метронидазолом, что свидетельствует о значительной роли этих бактерий.Вирусы могут играть определенную роль, 35 , возможно, также вызывая подавление иммунитета.

Руководство включает:

Инструкцию по санации полости рта и гигиене

жидкости для полоскания рта пероксидом или перборатом

метронидазол 200 мг три раза в день. на 3 дня.

Гангренозный стоматит (cancrum oris, noma)

Noma происходит от греческого «nomein», что означает «пожирать».По сути, это гангренозный стоматит, который начинается во рту как доброкачественное поражение ротовой полости и быстро разрушает как мягкие, так и твердые ткани рта и лица (рис. 27.4). 36 Большинство больных номой моложе 6 лет, и, по оценкам, летальность составляет от 70% до 90%. По оценкам, каждый год 100 000 африканских детей в возрасте до 6 лет заболевают номой. 36

Нома часто является продолжением ANUG в прилегающие ткани, главным образом из-за нарушения защиты хозяина (Рисунок 27.5). 37 Другие факторы, предрасполагающие к развитию гангренозного стоматита, включают белково-энергетическое недоедание и дефицит витаминов A, B, C, железа или магния. Следовательно, плохая среда обитания, подверженность изнурительным детским заболеваниям, плохая гигиена полости рта и недоедание, по всей видимости, подвергают детей риску развития номы. 38

Состояние особенно заметно в странах Африки к югу от Сахары. 39 Нигерия, вероятно, имеет самый высокий уровень заболеваемости, хотя Гамбия, Алжир, Уганда, Сенегал, Мадагаскар, Южная Африка, Судан и Египет также являются регионами с высокой распространенностью, а также Афганистан, Индия, Филиппины, Китай, Вьетнам, Папуа-Новый Гвинея и Южная Америка. 40 В развитых странах гангренозный стоматит встречается редко и обычно наблюдается у людей с ослабленным иммунитетом, таких как ВИЧ-инфекция, лейкемия и диабет. 41–45

Клинические признаки

Представляющим признаком может быть болезненное красное или пурпурно-красное пятно (затвердевшая папула), обычно на десне в области премоляров и моляров, которое быстро увеличивается и изъязвляется, распространяясь на лабиогингивальная или слизисто-буккальная складка, обнажая подлежащую кость.Боль и часто неприятный запах. На коже появляется сине-черный участок обесцвечивания, ведущий к перфорирующей ране. Секвестрация обнаженной кости и потеря зубов происходят быстро, а затем рана медленно заживает вторичным натяжением, часто оставляя дефект. В прежние времена нома часто приводила к летальному исходу.

Ведение

Гангренозный стоматит не поддается лечению, если не лечить основное заболевание, особенно диетологическую реабилитацию. Рану следует регулярно очищать хлоргексидином и / или физиологическим раствором и / или перекисью водорода.Можно использовать повязку из мягкой хлопковой марли или тюль-гра, но ее нужно часто менять. Следует удалить любые швабры, расшатанные зубы и костные фрагменты. Для коррекции обезвоживания и электролитного дисбаланса следует вводить парентеральные жидкости. Пенициллин - это противомикробный препарат выбора. Могут потребоваться фолиевая кислота, железо, аскорбиновая кислота и комплекс витаминов B.

Сифилис (венерический трепонематоз)

По оценкам, в 1995 году во всем мире было зарегистрировано примерно 12 миллионов новых случаев сифилиса среди взрослых, причем наибольшее количество случаев было зарегистрировано в Южной и Юго-Восточной Азии, за которой следует Африка к югу от Сахары. . 46

Поражения полости рта

Губа является наиболее частым экстрагенитальным местом первичной инфекции Treponema pallidum . Он вызывает шанкр (первичный, твердый или шанкр Хантера), который начинается с небольшого твердого розового пятна, превращается в папулу, а затем изъязвляется, образуя безболезненную круглую язву с приподнятым краем и уплотненным основанием. Около 60% оральных случаев поражают губу или могут присутствовать в углах рта. 47 Другие пораженные участки полости рта могут включать язык и, в меньшей степени, десны и зев.Лимфатические узлы в подчелюстной, подподбородочной и шейной областях обычно увеличены. Шанкры заживают спонтанно в течение 3–8 недель. Вторичный сифилис следует за первичной стадией через 6–8 недель, но заживающий шанкр все еще может присутствовать. Как и на начальной стадии, поражения слизистой оболочки очень заразны. Типичными признаками и симптомами являются лихорадка, головная боль, недомогание, сыпь (характерно симметрично распределенные медные макулопапулы или поражения на ладонях) и общее безболезненное увеличение лимфатических узлов.Именно эта стадия обычно вызывает поражение ротовой полости. 48 Безболезненные язвы в полости рта (слизистые пятна и язвы улиток) являются типичными поражениями и представляют собой слегка приподнятые серовато-белые блестящие пятна на зеве, мягком небе, языке, слизистой оболочке щек и, реже, деснах. 49 Шейные узлы увеличены и имеют эластичную консистенцию. Скрытый сифилис следует за вторичным сифилисом и сохраняется до тех пор, пока не разовьется поздний сифилис (третичный сифилис). Характерным поражением третичного сифилиса является локализованная срединная гранулема («гумма») размером от миллиметров до нескольких сантиметров, которая распадается, образуя глубокую перфорированную безболезненную язву (Рисунок 27.5). Наиболее частым участком гуммы в полости рта является твердое небо 49 , хотя обычно поражаются мягкое небо, губы или язык. Десна начинается с небольшого бледного приподнятого участка, который изъязвляется и быстро прогрессирует до большой зоны некроза с обнажением кости и, в случае небной десны, может в конечном итоге пробить нос в полость носа. 50

Диагноз

Наличие клинических проявлений вместе с историей контактов может указывать на диагноз, но для подтверждения требуются серодиагностические тесты и иногда микроскопия в темном поле.

Пероральное лечение

Не существует специального перорального лечения, кроме общей паллиативной помощи, если есть болезненность мягких поражений полости рта, но общее лечение простое: следует ввести прокаин пенициллин внутримышечно в течение 10 дней (эритромицин в течение 14 дней).

Невенерические трепонематозы (эндемические трепонематозы): эндемический сифилис (bejel)

Ранняя стадия bejel может проявляться слизистыми пятнами в ороназофарингеальной области и ангулярным стоматитом.Заболевание на поздней или третичной стадии в основном носит гумматический характер и может поражать слизистые оболочки или кости ротовой полости и может приводить к серьезной деформации лица (мутильный ринофарингит). 51

Диагноз

Темнопольная микроскопия и серологические исследования необходимы для подтверждения диагноза, но дифференцировать от других трепонематозов сложно.

Управление

Пенициллин - препарат выбора; тетрациклин и эритромицин - альтернативы.

Pinta

Первичное медленно развивающееся подкожное гранулематозное поражение может поражать лицо.Вторичные поражения (пинтиды) представляют собой папулы, которые развиваются в бляшки с чешуйчатыми и центрально пигментированными участками. Кожа лица сильно поражена, но поражений полости рта не описано.

Фрамбезия (framboesia, pian, bouba)

Первичная папула может появиться вокруг отверстий тела, включая рот (рис. 27.6). 52 Могут развиться гумматозные узловатые язвенные поражения. 52 Другой тип поражения, затрагивающий структуры лица, в основном представляет собой деструктивное поражение, начинающееся на мягком небе, язычке или твердом небе, в конечном итоге разрушающее части носа (гангозу) и вызывающее дефект «седло-нос».Поражение костей может привести к утолщению лица по обе стороны от переносицы, вызывая характерный вид лица «гунду». 53

Диагностика

Полезны клинические признаки, подтвержденные темнопольной микроскопией, биопсией и серологией.

Управление

Используется пенициллин, эритромицин или тетрациклин.

Гонорея

Поражение полости рта, глотки и миндалин сообщается все чаще, особенно среди гомосексуалистов и гетеросексуалов, практикующих оральный секс.Заражение этих участков происходит в первую очередь в результате фелляции и нечасто куннилингуса. Миндалины становятся красными и опухшими с сероватым экссудатом, возникает шейный лимфаденит. Поражения в других частях рта описываются как огненная эритема и иногда отек, возможно, с болезненными поверхностными изъязвлениями языка, десен, слизистой оболочки щек, твердого или мягкого неба. Воспаленная слизистая оболочка также может быть покрыта желтоватым или сероватым экссудатом, который при отделении может оставлять кровоточащую поверхность.

Диагноз

Для окрашивания по Граму необходимо взять мазок из зева, чтобы выявить полиморфы, содержащие грамотрицательные диплококки. Подтверждением является посев и сахарное брожение, чтобы помочь дифференциации видов. Возможна быстрая идентификация гонококков с помощью методов флуоресцентных антител.

Управление

Пенициллин - препарат выбора, принимаемый в виде 2 г ампициллина плюс 1 г пробенецида в виде однократной пероральной дозы. Пациентов с гиперчувствительностью к пенициллину можно лечить котримоксазолом.Многие штаммы устойчивы к пенициллину в некоторых частях Африки и на Дальнем Востоке. Могут использоваться тетрациклин или цефазолин-пробенецид и стрептомицин или спектиномицин.

Паховая гранулема (донованоз)

Папула или узелок, обычно в паховой или аногенитальной области, прогрессирует до деструктивной гранулематозной язвы. Большинство поражений полости рта являются вторичными по отношению к первичной инфекции половых органов, могут поражать пародонт и часто ошибочно диагностируются как актиномикоз.

Диагноз

Прямое исследование куска грануляционной ткани, сжатого между двумя предметными стеклами и окрашенного по Гимзе, на наличие тельцов Донована (скопления бацилл, лежащих в лейкоцитах) - лучший метод.

Ведение

Тетрациклин, ампициллин или триметоприм-сульфаметоксазол являются терапией первой линии.

Lymphogranuloma venereum

Язык - это место в полости рта, наиболее часто поражающееся при инфекциях первичной венерической лимфогранулемы (LGV), обычно с безболезненным пузырьком. Описаны поражения губ, щек, языка, дна рта, язычка и глотки, но не десен. По мере прогрессирования болезни язык увеличивается с участками рубцов и глубоких бороздок на спине, которые сильно краснеют с потерей поверхностного эпителия.Шейная лимфаденопатия встречается часто, иногда без клинических поражений полости рта LGV.

Диагноз

Лабораторное подтверждение диагноза включает выделение Chlamydia trachomatis и серологические тесты. C. trachomatis выделен на культурах клеток желточного мешка куриных эмбрионов. Кожная проба (проба Фрея) доступна, но не специфична.

Лечение

LGV лечится сульфонамидами, тетрациклином, эритромицином или рифампицином.

Актиномикоз

Нарушение целостности слизистой оболочки, вызванное травмой или хирургическим вмешательством, является предпосылкой для большинства актиномикотических инфекций. Цервикофациальный актиномикоз возникает преимущественно у взрослых мужчин в результате травмы либо случайно, либо, реже, в результате стоматологического лечения, такого как удаление зубов или эндодонтия. 54 Редко пародонтальный карман с подходящими анаэробными условиями предрасполагает к заболеванию. 55 Перимандибулярная область является наиболее частым участком.Относительно безболезненное уплотнение красновато-пурпурного цвета появляется под углом челюсти или около околоушной железы. Через пазухи может стекать материал, содержащий так называемые гранулы серы. Актиномикоз может редко поражать ротовую полость, язык, нижнюю челюсть, верхнюю челюсть, придаточные пазухи носа, глаз, ухо, лицо, шею или слюнные железы.

Диагноз

Гранулы серы можно увидеть прямым зрением или после окрашивания красителем по Граму. Актиномикоз должен быть подтвержден выделением A.israelii в анаэробной культуре.

Управление

Пенициллин - противомикробный препарат первого выбора. Альтернативы включают цефалоспорин, клиндамицин и линкомицин.

Нокардиоз

Нокардиоз вызывается бактериями семейства Nocardiaceae, обычно Nocardia asteroides , N. brasiliensis или N. caviae , и встречается в основном в Латинской Америке. Распространение может привести к оральному поражению; зарегистрировано нокардиоз щеки 56 и десны 57 .

Диагноз

Мазки следует исследовать на наличие грамположительных палочек кокковых форм, но посев более полезен для диагностики.

Управление

Следует использовать хирургический дренаж и сульфонамид, например ко-тримоксазол.

Туберкулез

По оценкам, в странах Африки к югу от Сахары ежегодно регистрируется более 1,5 миллиона случаев туберкулеза. 58 ВИЧ и туберкулез ускоряют прогресс друг друга, причем на последний приходится около 15% смертей от СПИДа во всем мире. 58

Поражения полости рта наблюдаются в основном при туберкулезе легких, хотя системные симптомы, указывающие на заболевание легких, присутствуют далеко не всегда. 59 Помимо боли, обычно основным признаком туберкулеза являются хронические язвы или зернистые образования. Обычно они находятся на тыльной стороне / основании языка, 50–62 деснах (Рисунок 27.7) 59 или иногда на слизистой оболочке щек, дне рта, губах, твердом и мягком небе. 63–65

Первичные поражения ротовой полости развиваются, когда бациллы попадают непосредственно в ткани полости рта человека, который не приобрел иммунитет.Первичный туберкулез ротовой полости чаще встречается у детей и подростков, чем у взрослых. Обычно это одиночная безболезненная безболезненная язва, обычно на десне с увеличенными шейными лимфатическими узлами, 66 или деснами, лунками для удаления зубов и щечными складками. 67

Сообщалось о единичных случаях туберкулеза первичной челюсти, 68 , как правило, в результате расширения поражения десны, инфицированной лунки после удаления, расширения от туберкулезной гранулемы на вершине зуба или гематогенного происхождения. распространять.Туберкулезный остеомиелит может поражать, в частности, верхнюю или нижнюю челюсть. Распространена та же общая картина, что и для других пораженных костей, с медленным разрежением остита, приводящим к секвестрации кости. 69 Боль не является заметным ранним признаком, но проявляется позже. Вторичная инфекция может затруднить постановку диагноза. Туберкулезное поражение нижней челюсти вызывает симптомы боли, отека, затруднения при приеме пищи, тризма, парестезии нижней губы и увеличения регионарных лимфатических узлов. 68–74 Инфекция может распространяться по челюсти, образуя множественные пазухи, которые отводятся внутри или вне рта. 75–76 Как правило, поражаются задняя нижняя челюсть и восходящая ветвь, а рентгенологические признаки включают неправильные линейные кальцификации вдоль нижней границы и нерегулярные просветы в кости челюсти. 68 В верхней челюсти инфраорбитальная область, особенно у молодых, обычно поражается. Как правило, развивается холодный абсцесс, который в конечном итоге может стекать через свищи 77 , но иногда может присутствовать прочное внутрикостное поражение. 78

ТБ при СПИДе может поражать слюнные железы
Диагноз

Диагноз туберкулеза легких, предполагаемый хроническим кашлем, кровохарканьем, потерей веса, ночным потоотделением и лихорадкой, подтверждается физическим обследованием, рентгенографией грудной клетки, мазки и посев мокроты, туберкулиновые тесты (проба Манту или Хефа). 79 Биопсия очага поражения должна быть исследована гистологически, и кислотостойкие окрашивания и посев микроорганизмов являются абсолютным доказательством заболевания.

Ведение

Обычная химиотерапия туберкулеза состоит из введения двух или более активных препаратов в течение от 18 месяцев до 2 лет. Может потребоваться изониазид в комбинации с этамбутолом, тиацетазоном или пара-аминосалициловой кислотой и, в зависимости от тяжести заболевания, стрептомицин внутримышечно в течение первых 2–3 месяцев. Другие доступные препараты включают рифампицин, пиразинамид и этионамид.

Нетуберкулезные микобактериальные инфекции

Нетуберкулезные (атипичные) микобактерии (НТМ) включают Mycobacterium avium и M.intracellulare ( комплекс M. avium-intracellulare : MAC), M. scrofulaceum и M. haemophilum . Все чаще сообщается об инфекциях, вызванных НТМ, особенно у лиц с ослабленным иммунитетом. 80 Цервикальная лимфаденопатия иногда вызывается НТМ, но поражения полости рта встречаются редко.

Ведение

Атипичные микобактерии могут быть устойчивыми к традиционной противотуберкулезной химиотерапии, хотя у детей с шейным лимфаденитом, вызванным только традиционной лекарственной терапией NTM 81 или циклосерин в очень устойчивых случаях могут быть эффективными, и только в некоторых случаях требуется хирургическое удаление. 82

Проказа

Точные оценки количества случаев проказы получить трудно, но примерно 2,2 миллиарда человек живут в районах, где проказа является серьезной проблемой, т. Е. Где распространенность такова, что существует риск заражения этой болезнью считается значительным. 83

Поражения полости рта чаще всего наблюдаются при лепроматозной лепре, 84–90 в виде узелков (лепром) на небе, языке или в других местах. Со временем они могут образоваться язвы и рубцы. 88,91–93 Лепроматозная проказа также поражает нервы (в конечном итоге с гипестезией), кожу, лимфатические узлы и другие ткани, включая кости, глаза, яички, почки и костный мозг. Туберкулоидная проказа вызывает утолщение кожных нервов, плоские и гипопигментированные или выпуклые и эритематозные поражения кожи и увеличение лимфатических узлов. 50

Диагноз

Диагноз обычно основывается на наличии анестезирующих поражений кожи и утолщенных периферических нервов, что подтверждается мазками из открытого очага поражения или биопсией.Лепроминовая проба, неспецифическая кожная проба на гиперчувствительность замедленного типа, дает положительный результат у многих людей из эндемичных регионов, независимо от того, лепротические они или нет.

Управление

Дапсон является стандартным лечением, но могут потребоваться клофазимин, рифампицин и протионамид, если M. leprae является устойчивым. 94

Волшебная жидкость для полоскания рта: эффективна при химиотерапии язв во рту?

Я слышал, что «волшебная жидкость для полоскания рта» может помочь с язвами во рту после химиотерапии.Что это такое?

Ответ Картика Гиридхара, доктора медицины

Волшебная жидкость для полоскания рта - это термин, используемый для лечения язв во рту, вызванных некоторыми формами химиотерапии и лучевой терапии.

Язвы во рту (мукозит полости рта) могут быть чрезвычайно болезненными и могут привести к неспособности есть, говорить или глотать.

Ополаскиватель для полости рта Magic не имеет стандартной формулы, но обычно содержит как минимум три из этих основных ингредиентов:

  • Антигистаминное или холинолитическое средство, которое может облегчить боль
  • Местный анестетик для уменьшения боли и дискомфорта
  • Антацид, обеспечивающий достаточное покрытие других ингредиентов внутренней части рта
  • Противогрибковое средство для уменьшения роста грибков
  • Кортикостероид для лечения воспаления
  • Антибиотик для уничтожения бактерий вокруг язвы

Большинство составов магической жидкости для полоскания рта предназначено для использования каждые четыре-шесть часов и подержать во рту в течение одной-двух минут перед тем, как выплюнуть или проглотить.Рекомендуется не есть и не пить в течение 30 минут после использования волшебной жидкости для полоскания рта, чтобы лекарство успело подействовать.

Побочные эффекты волшебной жидкости для полоскания рта могут включать проблемы со вкусом, жжение или покалывание во рту, сонливость, запор, диарею и тошноту.

Ополаскиватель для рта Magic может принести некоторое облегчение, но неясно, насколько он эффективен. Исследования волшебных жидкостей для полоскания рта дали противоречивые результаты. Некоторые не нашли никакой пользы. Одно недавнее исследование показало, что он лучше снимает боль, чем ароматизированная жидкость для полоскания рта при язвах во рту у людей, получивших облучение в области головы и шеи.

Поскольку стандартной формулы для решения не существует, трудно делать выводы по всем исследованиям. Некоторые медицинские организации не рекомендуют волшебную жидкость для полоскания рта, потому что нет достаточных доказательств ее эффективности.

Существует несколько версий волшебной жидкости для полоскания рта. Некоторые из них доступны в заранее отмеренных наборах, которые могут быть смешаны фармацевтами, а другие готовятся фармацевтом по заказу. Если будет установлено, что волшебная жидкость для полоскания рта может быть полезной, ваш врач выпишет рецепт.

Поговорите со своим врачом о конкретных методах лечения рака и о том, какие решения для борьбы с язвами во рту могут быть лучше всего для вас.

с

Картик Гиридхар, доктор медицины

23 ноября 2019 г. Показать ссылки
  1. Sio TT, et al. Влияние жидкости для полоскания рта доксепином или полоскания рта дифенгидрамин-лидокаин-антацид по сравнению с плацебо на боль при оральном мукозите, связанную с лучевой терапией. JAMA. 2019; DOI: 10.1001 / jama.2019.3504.
  2. Ополаскиватель для рта Magic: обновление.Письмо фармацевта. https://pharmacist.therapyresearch.com/Content/Detail-Documents/PRL/2009/Nov/Magic-Mouthwash-An-Update-251103#. Проверено 28 октября 2019 г.
  3. Лалла В.Р. и др. Руководство MASCC / ISOO по клинической практике для лечения вторичного мукозита после лечения рака. Рак. 2014; DOI: 10.1002 / cncr.28592.
  4. Clarkson JE, et al. Вмешательства по лечению мукозита полости рта у больных раком, получающих лечение. Кокрановская база данных систематических обзоров.2010; DOI: 10.1002 / 14651858.CD001973.pub4.
  5. McElhiney LF. Волшебные жидкости для полоскания рта: обзор литературы и обсуждение распространенных композиций. Международный журнал фармацевтических смесей. 2011; 15: 377.
  6. Ополаскиватель для рта Magic. Американская академия медсестер. https://www.aannet.org/initiatives/choosing-wisely/choosing-wisely---magic-mouthwash. Проверено 28 октября 2019 г.
  7. Гиридхар К.В. (заключение эксперта). Клиника Майо. 11 ноября 2019 г.
Посмотреть больше ответов экспертов

.

Нуклеокапсиды вируса везикулярного стоматита диффундируют через цитоплазму, перескакивая от ловушки к ловушке в случайных направлениях

частицы RNP были визуализированы в клетках, инфицированных рекомбинантным VSV, содержащим ген для усиленного зеленого флуоресцентного белка (eGFP), слитый в рамке с геном P (VSV -P-eGFP) 8 . Синтез вирусных РНК и белков в клетках, инфицированных этим вирусом, аналогичен синтезу вирусов с белком P дикого типа, хотя продуцируемый инфекционный вирус имеет примерно в 10 раз более низкий титр, вероятно, из-за менее эффективного включения P- eGFP слитый белок в вирусные частицы (приблизительно 50%) 8 .Распределение в цитоплазме инфицированных клеток вирусных РНП, меченных слитым белком P-eGFP, аналогично распределению РНП дикого типа VSV, меченных антителом против белка нуклеокапсида (N) 8,9 .

Клетки A549 человека инфицировали вирионами VSV-P-eGFP при множественности 3 БОЕ / клетку. Живые клетки визуализировали между 3 и 4 часами после инфицирования. В это время клетки содержат множество небольших флуоресцентных пятен, которые в основном представляют собой отдельные частицы РНП. Изображение такой клетки показано на рис.1. Этот период времени был выбран для того, чтобы иметь возможность анализировать перенос одиночных частиц РНП. В более позднее время частицы агрегируют в более крупные тела включения 9 . При наблюдении на глаз мелкие частицы слегка колеблются в случайных направлениях (см. Дополнительный фильм). Иногда частица движется в одном направлении от 0,2 до 1 с. Изображения, подобные рис. 1, были оцифрованы камерой CMOS научного уровня, работающей со скоростью 100 кадров / с. Стеки, содержащие 400 изображений, были сохранены для постобработки.

Рисунок 1

Изображения живой клетки A549 и единственной частицы rnp через 3 часа после заражения VSV-P-GFP. ( A ) Один кадр, показывающий одну ячейку. Маленькие пятна представляют собой флуоресцентные частицы РНП. Белыми линиями отмечены края клетки и ядра. ( B ) Увеличенное изображение одиночной частицы РНП, которая находилась в одной ловушке около ядра в течение 4 с. При таком увеличении видны отдельные пиксели. Расширенное изображение представляет собой среднее значение первых 32 кадров для улучшения отношения сигнал-шум с вычитанием плоского фона.Диаметр пятна определяется функцией рассеяния точки объектива, а не (меньшим) размером частицы rnp.

Частицы, подлежащие отслеживанию, были выбраны визуально и отслежены программным обеспечением Video Spot Tracker (CISMM, UNC-CH). Отслеживались только самые мелкие частицы, которые оставались в фокусе для всех 400 кадров. Трекер может обнаруживать частицы с субпиксельной точностью. В 32 ячейках отслеживалось более 200 частиц.

Новая гипотеза этой статьи заключается в том, что преобладающий тип движения частицы RNP - это подпрыгивание из стороны в сторону в ловушке или клетке и примерно раз в секунду, прыжки в ближайшую ловушку.Чтобы объективно обнаружить эти состояния и переходы между ними, мы построили смешанные модели с 1–6 двумерными гауссианами, чтобы они соответствовали стекам изображений из 400 кадров. Байесовские статистические методы использовались для оптимизации параметров каждой модели и определения того, какая модель имеет наибольшую вероятность соответствия данным. Скрытая марковская модель первого порядка использовалась с моделью наилучшей смеси для обнаружения переходов системы из одного состояния в другое и для присвоения наиболее вероятного состояния каждому кадру.В этих экспериментах переходы между состояниями происходят в масштабе времени 50 мс - 4 с. Это позволяет разделить 4-секундный трек на 1–10 более коротких «циклов», во время которых частица находится в одном состоянии. В литературе по информатике этот подход называется распознаванием образов и машинным обучением 16,17 .

После того, как дорожка была разделена на серии, логарифмический график зависимости среднеквадратичного смещения (MSD) от временной задержки (τ) между кадрами в этой серии показывает, рассеивается ли частица (наклон = 1) или задерживается (наклон = 0) или движется по цитоскелетному волокну (наклон> 1) в это конкретное время.Приступов свободно диффундирующих частиц РНП не наблюдалось. Вместо этого каждая наблюдаемая вспышка соответствовала либо пространственно локализованной ловушке, либо состоянию, в котором частица двигалась в основном в одном направлении. Доли треков с одним-шестью захваченными состояниями или, по крайней мере, с одним направленным состоянием показаны в таблице 1. Данные, подтверждающие эти результаты, описаны в следующих разделах.

Таблица 1 Распределение дорожек с 1-6 заблокированными состояниями или, по крайней мере, с одним направленным состоянием.

Дорожки с 1 состоянием

Для 3% треков байесовский анализ показал, что модель гауссовой смеси с одной гауссовой моделью была наиболее вероятной. Три примера таких треков показаны и проанализированы на рис. 2. Точки данных ограничены почти круглой областью с радиусом приблизительно 0,1 мкм. Цветовая кодировка времени в первом столбце показывает, что частицы перемещались в пределах домена случайным образом. Второй столбец - это результат анализа распознавания байесовских образов.Эллипсы во втором столбце отмечают пределы 2σ для двумерного гауссиана, который моделирует данные. Эти эллипсы почти круглые, показывая, что частицы RNP не имеют предпочтения по направлению, находясь внутри этих ловушек.

Рисунок 2

Частицы, занимающие одно состояние. Столбец A: сырые треки. Красный символ: frames1: 100; зеленый: 101: 200; синий: 201: 300; черный: 301: 400. Столбец B: наиболее вероятная модель, найденная с помощью вариационного байесовского анализа. Красные символы: первое (и единственное) состояние. Эллипсами отмечены пределы 2σ подобранных гауссианов.Стрелка в рамке в правом нижнем углу указывает от приблизительного центра ячейки до частицы. Столбец C, красная линия: логарифмический график MSD для частицы RNP в живой клетке. Синяя линия: логарифмический график MSD частицы RNP в фиксированной ячейке.

В третьем столбце на рис. 2 показаны графики MSD частиц в живых и фиксированных клетках. Небольшой наклон MSD для частиц RNP в живой клетке (красная линия) - это классический признак движения частицы в ловушке вперед и назад.Чистое смещение таких частиц за 4 с равно нулю. Синяя линия - частица РНП в фиксированной ячейке. Наблюдаемое MSD для фиксированных ячеек, скорее всего, является результатом дробового шума 18 . MSD для фиксированных ячеек составляет 20–25% от MSD для живых ячеек, поэтому дробовой шум не принимается во внимание.

Дорожки с 2, 3 или 4 состояниями

Около одной трети дорожек лучше всего соответствовали модели с 2, 3 или 4 состояниями. Один пример каждого из них показан на рис. 3. Необработанные треки до байесовского анализа показаны в первом столбце.Во втором столбце показаны те же треки после байесовского анализа, с цветом, используемым для различения состояний.

Рисунок 3

Дорожки с 2, 3 и 4 состояниями. Столбец A: сырые треки. Столбец B: треки после байесовского анализа, показывающие обнаруженные состояния и эллипсы, определяющие гауссовские пределы 2σ. Цветовая кодировка: красный - первое состояние, зеленый - второе состояние, синий - третье состояние, черный - четвертое состояние. Столбец C: графики журнала-журнала MSD для каждого состояния. Столбец D: номер состояния в сравнении с номером кадра.

В первой строке отображается дорожка только с двумя состояниями: красным и зеленым. Границы 2σ обоих состояний примерно круговые, что показывает, что движение внутри каждой из этих ловушек не направлено. Центры двух гауссиан в этом примере разделены примерно на 0,059 мкм. Переход от одной ловушки к другой дает чистое движение RNP, которое напоминает диффузию при просмотре в фильме, снятом с более низкой частотой кадров. Не было постоянного направления прыжков (см. Стрелки в правом нижнем углу).В третьем столбце показан график зависимости MSD от τ для каждого состояния. МСД обоих состояний почти не зависят от τ. Четвертый столбец показывает состояние частицы как функцию времени. График показывает, что существует единственный переход между состоянием 1 и состоянием 2 примерно на 200 кадре. Это означает, что частица первоначально была удержана ловушкой 1, а затем перемещена в ловушку 2. После того, как она переместилась во вторую ловушку, она не вернулась. к первому. Вероятная природа ловушек и вероятные механизмы ухода от одной ловушки к другой рассматриваются в Обсуждении.

Во второй строке показаны данные для частицы, занявшей 3 ловушки в течение 4-секундного окна наблюдения. Перекрытие между радиусами эллипсов немного больше, чем в предыдущем случае, но кривые 3 MSD снова имеют почти нулевой наклон. График в столбце D показывает один переход между состояниями 1 и 2 и один переход между состояниями 2 и 3.

В третьей строке показаны результаты для дорожки с 4 состояниями. Между четырьмя гауссианами есть некоторое перекрытие, но каждый занимает отдельную область в цитоплазме.Все 4 МСД имеют наклон, близкий к нулю. Четвертый столбец показывает, что переходы между состояниями не всегда необратимы.

Аналогичные результаты наблюдались для треков с 5 и 6 состояниями. Переходы между этими состояниями чаще были обратными.

Распределение размеров ловушек и расстояния от ловушки до ловушки

Хотя в этой рукописи делается упор на анализ отдельных треков, полезно оценить глобальные распределения размера ловушек и расстояния между ловушками для переноса частиц VSV RNP.На рисунке 4 показаны гистограммы этих двух ключевых параметров для всех треков (примерно 200), кроме тех, которые показывают направленное движение.

Рис. 4

Гистограммы размера ловушки и расстояния от ловушки до ловушки. ( A ) Распределение вероятностей ширины σ = (σ x + σ y ) / 2 наиболее вероятных двумерных гауссианов для каждой ловушки. Наиболее вероятное значение σ, оцененное по трем самым высоким ячейкам, составляет приблизительно 0,060 мкм. ( B ) Гистограмма расстояния между центрами ловушек.Исключаются треки с направленным движением. Наиболее вероятное значение межцентрового расстояния, рассчитанное по 4-м самым высоким ячейкам, составляет 0,17 мкм. Подсчеты для расстояний более 0,5 мкм могут быть завышены из-за ошибок в последовательной нумерации состояний.

Дорожки, показывающие направленное движение

7 из 223 дорожек показали направленное движение во время как минимум 1 состояния. Направленное движение определялось в первую очередь по эксцентриситету эллипса, содержащего данные xy одного состояния.Если a = большая ось эллипса и b = малая ось эллипса, то отношение a / b, называемое эксцентриситетом, является мерой направленности пути. Если частицы не имеют предпочтений по направлению, эллипс представляет собой круг, а эксцентриситет = 1. Если частицы предпочитают двигаться в одном направлении относительно центральной точки гауссова состояния, эллипс становится удлиненным в этом направлении, и эксцентриситет может подъем до 8. Все гусеницы с эксцентриситетом> 2,5 были классифицированы как «направленные».На рисунке 5 показаны два примера таких треков. Оба трека представляют собой смесь направленных и захваченных состояний. Первый пример на рис. 5 имеет 3 направленных состояния с эксцентриситетами = 7,3, 7,2 и 4. Остальные 3 состояния имеют эксцентриситет в среднем до 1,8. Во втором примере есть одно сильно направленное состояние с эксцентриситетом = 6.5 и 5 захваченных состояний со средним эксцентриситетом, равным 1,7. Каждое из состояний, классифицируемых как направленное, имеет два дополнительных индикатора направленного движения. Во-первых, отдельные точки xy внутри эллипса не заполняют эллипс случайным образом со временем.Скорее, точки xy систематически заполняют эллипс во времени от одного конца эллипса до другого. Напротив, эллипсы захваченных состояний со временем заполняются в случайных местах. Вторым дополнительным индикатором направленного поведения является наклон логарифмических графиков СКО для направленных состояний, показанных в третьем столбце рис. 5. Наблюдаемые наклоны составляют от 1 до 2. Такие состояния иногда называют «супердиффузионными». ». Наблюдаемые средние скорости частиц РНП в двух треках, показанных на рис.5 составляли 0,75 мкм / с и 1,05 мкм / с. Они находятся в диапазоне, измеренном для моторов кинезина и миозина во время in vitro анализов подвижности 19,20 . Обратите внимание, что направленное движение иногда происходит к ядру, а иногда от ядра.

Рисунок 5

Дорожки, показывающие ведомое движение. Показаны два примера треков, которые представляют собой смесь захваченного и ведомого состояний. Столбец A: сырые треки. Столбец B: треки после байесовского анализа, показывающие обнаруженные состояния и эллипсы, определяемые пределами 2σ гауссиан.Цветовая кодировка такая же, как на рис. 2. Стрелка в прямоугольнике в правом нижнем углу указывает от центра ячейки к частице. Частица в строке 1 движется к центру ячейки. Частица в строке 2 удаляется от центра ячейки. Столбец C показывает диаграмму журнала регистрации МСД для управляемых состояний; MSD захваченных состояний не показаны для ясности. Столбец D представляет собой график зависимости номера штата от номера кадра. Первый пример полностью переходит из состояния 1 в состояние 6. Второй пример более сложен; некоторые штаты посещаются более одного раза.

Относительные вклады прыжков и ведомого движения в перенос частиц RNP

В таблице 1 223 трека разделены на 7 групп в соответствии с количеством захваченных состояний (K = от 1 до 6) или имеющих 1 или более ведомых состояний. {2}} \ rangle \) для треков с ловушками.Для K = 1, d K = 0, потому что перескока нет. Для K = от 2 до 6 d K монотонно увеличивается от 0,25 до 1,14 мкм (таблица 1, столбец 4). Для гусениц со смесью ведомого и заблокированного состояний d ведомый оценивался вручную путем измерения длины пути от конца до конца, а не межцентрового расстояния. Среднее направленное смещение за 4 с для 7 треков составило 1,17 мкм.

Поток смещения частиц Φ всего возникает в результате прыжков и направленного движения.{6} {f} _ {K} {d} _ {K} + {f} _ {направил} {d} _ {направил} $$

(1B)

$$ {{\ boldsymbol {\ Phi}}} _ {total} = 0,77 \, \ mu m + 0,035 \, \ mu {\ rm {m}} $$

(1С)

Поток смещения частиц, возникающий в результате прыжков, примерно в 20 раз больше потока смещения частиц, возникающих в результате направленного движения, в первую очередь потому, что прыжки происходят гораздо чаще, чем движимое движение. Экспериментальный тест на более длительное время и на большие расстояния был бы полезен, но он не простой из-за фотообесцвечивания.

Модель движения RNP-частиц в гармонической ловушке

Мы проверили, можно ли моделировать наблюдаемые движения захваченных RNP-частиц с помощью решений уравнения Ланжевена для тепловых движений сферы, погруженной в вязкую жидкость с добавленным гармоническим потенциалом. . В этом случае уравнение Ланжевена имеет 4 члена, возникающих из-за инерции, вязкого сопротивления, потенциальной ямы и стохастических столкновений растворителей 21 :

$$ \ mathop {\ underbrace {m \ ddot {x} (t)}} \ limits_ { {\ rm {inertia}}} = \ mathop {\ underbrace {- \, \ gamma \ dot {x} (t)}} \ limits _ {\ mathop {{\ rm {viscous}}} \ limits _ {{\ rm {drag}}}} + \ mathop {\ underbrace {kx (t)}} \ limits _ {\ mathop {{\ rm {force}} \, {\ rm {of}}} \ limits _ {{\ rm {trap }}}} + \ mathop {\ underbrace {\ sqrt {2 {k} _ {B} T \ gamma} \, W (t)}} \ limits _ {\ mathop {{\ rm {force}} \, { \ rm {of}} \, {\ rm {растворитель}}} \ limits _ {{\ rm {collisions}}}} $$

(2)

Здесь m - масса частицы, γ - коэффициент вязкого сопротивления жидкости на сфере, k - жесткость пружины ловушки, k B - постоянная Больцмана, T - температура в Кельвинах, а Вт (t) - стохастический процесс Вейнера со средним значением = 0 и стандартным отклонением = 1.Согласно закону Стокса коэффициент сопротивления γ равен 6πηR, где η - вязкость жидкости, принимаемая равной 0,006 Па · с 1 , а R - радиус сферы, принимаемый равным 0,086 мкм 7 .

Численное интегрирование этого стохастического дифференциального уравнения дает x (t). Второе измерение y (t) получается таким же образом. Жесткость пружины регулируется таким образом, чтобы площадь моделируемого трека приблизительно соответствовала экспериментально наблюдаемой площади трека частиц, которые остаются в одной ловушке в течение периода наблюдения (рис.2). На рисунке 6 показаны результаты моделирования для захваченных и неуловленных частиц и сравнение моделирования с наблюдаемыми данными.

Рисунок 6

Решения уравнения Ланжевена с ловушкой и без нее и сравнение с экспериментальными данными. ( A ) Синяя линия: численное решение уравнения Ланжевена для сферической частицы, совершающей свободное броуновское движение (без ловушки) в вязкой среде. Красные символы: смоделированный трек xy для того же радиуса частицы, вязкости и температуры, но с добавленным гармоническим потенциалом k x и k y = 1.5Е-06 Н / м. Оба моделирования рассчитаны на 400 шагов длительностью 10 мс каждый. ( B ) Диаграммы логарифма МСД смоделированных треков захваченных и не захваченных частиц. ( C ) Спектральная плотность мощности смоделированных треков, показанных на панели A. Обе кривые представляют собой среднее значение 10 моделирования для снижения шума. ( D ) Экспериментальный xy-трек частицы РНП в ловушке. ( E ) Логарифмический график экспериментального МСД для одиночной частицы в ловушке. ( F ) Спектральная плотность мощности экспериментального трека частицы РНП в одиночной ловушке.

Численные решения уравнения Ланжевена с ловушкой и без нее показаны на рис. 6А. Без ловушки частица занимает пространство примерно 1 мкм x 1 мкм. Когда потенциальная яма с жесткостью пружины k x = 1,5 × 10 -6 Н / м добавляется к уравнению. 2, занимаемая площадь уменьшается примерно до 0,2 мкм × 0,2 мкм, что составляет 1/25 площади. На рис. 6В показан график регистрации МСД двух смоделированных треков. На рисунке 6C показана спектральная плотность энергии этих двух смоделированных трасс.Свободное броуновское движение показывает ожидаемую зависимость от τ 1 на графике MSD и частотную зависимость 1 / f 2 на графике спектральной плотности мощности. Спектральная плотность энергии моделируемой частицы в ловушке в значительной степени не зависит от f в пределах экспериментальных временных рамок.

Пример экспериментального трека для частицы RNP, которая занимала одиночную ловушку, показан на рис. 6D для сравнения с моделированием. При выборе жесткости пружины k площадь, занимаемая моделируемой частицей в гармонической ловушке, аналогична площади, занимаемой экспериментально.MSD и спектральная плотность энергии моделирования (рис. 6B, C) хорошо согласуются с экспериментом (рис. 6E, F) без корректировки дополнительных параметров.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *