Рак корня языка: Наиболее частые симптомы рака языка

Содержание

Рак языка | Диагностика и лечение рака языка на любых стадиях

Рак языка возникает в результате мутаций клеток эпителия, выстилающего его слизистую. Он относится к злокачественным заболеваниям головы и шеи, а в онкологии ротовой полости и ротоглотки на долю именно этой локализации приходится более половины всех случаев. Хотя опухоль довольно просто заметить при визуальном осмотре, часть людей игнорируют первые признаки и упускают время для эффективного лечения — новообразование отличается агрессивным ростом и быстрым метастазированием. Поэтому важно при первых признаках изменения слизистой незамедлительно обратиться к врачам для установления диагноза.

К причинам, провоцирующим онкологию языка, относят курение и употребление жевательных смесей, особенно в сочетании с алкоголем, употребление слишком горячей и острой пищи, частые травмы слизистой в результате прикусывания, неправильно установленных зубных пломб, протезов или коронок, привычки держать во рту карандаши и другие острые и твердые предметы, взаимодействия с канцерогенами в процессе профессиональной деятельности, ВПЧ, ВИЧ, СПИД.

Классификация

Около 90 % случаев приходится на плоскоклеточный рак языка, другие по гистологии новообразования встречаются редко. По тому, как растет опухоль, выделяют экзофитную и эндофитную разновидности: первая выдается в ротовую полость, вторая уходит в толщу языка, приводя к отеку и негативно влияя на его подвижность. По расположению разделяют рак корня языка (около 20 %), его тела (70 %) и нижней части под языком (10 %). По внешнему виду папиллярная форма выглядит как нарост с бугристой поверхностью, язвенная — окруженная валиком язвочка, инфильтративная — уплотнение, также есть язвенно-инфильтративная.

Госпитализация онкологических больных. Ежедневно. Круглосуточно

Нам доверяют 9500 пациентов ежегодно.

Отправьте документы на почту [email protected] Возможность проведения лечения рассмотрит главный врач клиники Антон Александрович Иванов, онколог-хирург, кмн

Рак языка: стадии и симптомы

На первой начальной стадии новообразование затрагивает только верхние слои слизистой, безболезненно, визуально напоминает налет и часто даже врачами не онкологами принимаются за менее опасные заболевания слизистой, например глоссит.

На следующем этапе болезнь прогрессирует, распространяясь на соседние ткани языка. Клинические проявления становятся заметными — появляется боль, отдающая в уши, виски или шею, усиливается слюноотделение, опухоль может гноиться и кровоточить, многие отмечают ощущение онемения и неприятный запах изо рта, из-за отека затрудняется жевание и глотание, а также нарушается артикуляция.

На третьем этапе злокачественные процессы затрагивают шейные и ушные лимфоузлы, опухоль прорастает в соседние органы, включая кости черепа. Явно наблюдаются признаки распада тканей во рту, затруднен процесс принятия пищи, происходит потеря аппетита, резкое снижение массы тела, появляется слабость, утомляемость, повышенная температура — все это признаки раковой интоксикации организма.

Рак языка 4 стадии называют терминальным — опухоль распространяется по тканям и органам головы и шеи, метастазирует в отдаленные органы, чаще всего в печень, легкие, кости. Медицинская помощь в таких случаях призвана облегчить состояние пациента и снизить выраженность симптоматики и интенсивность боли, однако победить болезнь уже практически невозможно.

Диагностика

Для установления диагноза используют визуальный осмотр и пальпацию, взятие мазка, цитологические и гистологические исследования, УЗИ, для выявления метастазов применяют МРТ и КТ, рентгенографию, другие диагностические методики. Также помогает выявить рак языка онкомаркер SCC.

Рак языка: лечение и прогноз

Тактика борьбы с болезнью определяется с учетом специфики опухоли, стадии ее развития, состояния пациента и анамнеза. Как и для других видов раковых заболеваний, операции, лучевая терапия и химиотерапия при раке языка являются основными лечебными направлениями и используются чаще всего в комплексе.

При подозрениях или установленном диагнозе не откладывайте — обратитесь в клинику НАКФФ за диагностикой и лечением онкологических заболеваний как можно скорее. Здесь же можно пройти реабилитацию после хирургического вмешательства и других манипуляций и получить паллиативную помощь. Запись на предварительную консультацию возможна по тел. +7 (495) 431-32-35

В Тюмени восстановили язык пациенту с последней стадией рака — Российская газета

Тюменские онкологи смогли восстановить язык пациента, использовав для этого ткани руки и мышцы полости рта. По словам врачей, мужчина уже начинает говорить и научился глотать пищу (а будущем даже сможет чувствовать ее вкус, так как корень языка удалось сохранить).

История необычного пациента началась осень прошлого года, когда он поступил в больницу с подозрением на злокачественное новообразование. Диагноз был неутешительным: рак языка 4 стадии.

«Опухоль размерами 2,5 на 6 сантиметров поражала не только язык, но и другие ткани полости рта. При таком положении дел оперировать нельзя, сначала нужно уменьшить размеры опухоли», — поясняет Ирина Литвиненко, пресс-секретарь клиники «Медицинский город».

С помощью тончайших катетеров мужчине вводили химиотерапевтический препарат именно в те сосуды, которые питают анатомическую область с новообразованием.

«Такая высокоточная адресная доставка эффективно воздействует на опухолевый процесс не только как самостоятельный вид лечения, но и в сочетании с лучевой терапией. Комплексное воздействие позволило нам уменьшить новообразование до неопределяемых размеров», — говорит Лаврентий Дьяков, завотделением рентгенохирургических методов диагностики и лечения.

Чтобы окончательно устранить злокачественный процесс, онкологам пришлось полностью удалить пациенту язык, что в дальнейшим потребовало реконструкции органа. Микрососудистая операция по его восстановлению длилась 11 часов.

«Мы оставили только корень языка. Выделили ткань руки и мышцы, которые выстилают дно полости рта, и сконструировали язык обычной анатомической формы. На то место, откуда мы взяли ткань для него, пересадили часть кожи живота», — рассказала Юлия Шубина, заведующая онкологическим отделением № 2.

Операция прошла успешно, пациент излечился от рака, а для стороннего наблюдателя тот факт, что язык был заменен, будет совершенно не заметен. Сам мужчина начинает понемногу привыкать к органу: он уже может глотать пищу, начинает пользоваться речью. А так как корень языка был сохранен, и на нем остались рецепторы, в будущем пациент сможет чувствовать вкус еды.

Онкология

Дмитриев Сергей Павлович ― хирург-онколог по профилю опухоли головы и шеи диспансерного отделения ГБУЗ «Областной онкологический диспансер»

440071, г. Пенза, пр. Строителей, д. 37А, тел. (8412) 41-30-55, e-mail: Этот адрес электронной почты защищён от спам-ботов. У вас должен быть включен JavaScript для просмотра.

Реферат.

В настоящей статье представлен опыт успешного выполнения двух глоссларингэктомий с пластикой дефекта тканей дна полости рта и глотки свободным висцеральным лоскутом. В обоих случаях показанием к выполнению операции был рецидивный рак корня языка.

Ключевые слова: глоссэктомия, ларингэктомия, микрохирургическая реконструкция, висцеральный аутотрансплантат.

Введение

В общей структуре онкологических заболеваний злокачественные новообразования головы и шеи составляют в среднем от 20 до 30%. В 2013 г., по данным GLOBOCAN, показатели заболеваемости и смертности от рака головы и шеи  в мире составляли 1 116 000 и 763 000 соответственно. Для сравнения в 2007 г. [2], в мире было зарегистрировано всего около 600 000 новых случаев. Тенденция роста заболеваемости раком ротоглотки в России неутешительна и сравнима с общемировой. За 10 лет, в период с 2001 по 2011 гг., показатели заболеваемости возросли с 26 до 32,9 на 100 000 населения [3]. И, несмотря на широкие возможности ранней диагностики 60-70% опухолей выявляются на III-IV стадии.

Основным методом лечения больных местно-распространенным раком корня языка в настоящее время является лучевой. Результаты лечения, особенно у больных без регионарных метастазов, вполне удовлетворительны [4]. Отдаленные результаты консервативного и комбинированного подхода сопоставимы, что в свою очередь, учитывая предполагаемый объем хирургического вмешательства, еще раз определяет выбор органсохранного подхода [6]. В то же время, основным радикальным методом лечения рецидивов опухоли корня языка является глоссэктомия, зачастую в комбинации с ларингэктомией и/или резекцией ротоглотки [5]. Комбинированная глоссэктомия психологически весьма тяжело переносится больными. Они социально дезадаптированы ввиду наличия трахеостомы и отсутствия речи. Пациенты вынуждены принимать протертую пищу, из-за невозможности пережевывания пищи. Сложность и стойкость нарушенных функций, сопровождается длительной и нередко стойкой утратой трудоспособности. Так, после удаления гортани к прежней работе возвращаются только 18%, к легкой ― 21,5%, не работают ― 60,5% больных [1]. Все эти факторы отнесены к тяжелым стрессовым состояниям человека (Американская классификация психических расстройств DSM-IV-R, четвертая ось, 1998).

Расширенные хирургические операции с резекцией нескольких органов ротоглотки сложно отнести к рутинным. Формирующиеся дефекты тканей требуют пластического замещения с целью максимального возможного восстановления функций и возвращения пациента в социум. Таким образом, хирургические бригады, выполняющие подобные операции, должны владеть различными технологиями лоскутной пластики, в том числе с использованием микрохирургического компонента.

Клинический случай 1

Пациент Б., 1964 г.р., в ноябре 2015 года обратился в диспансерное отделение ГБУЗ ООД г. Пензы. По данным фиброларингоскопии (ФЛС) от 18.11.2015 г. между корнем языка и надгортанником бугристая опухоль с налетом фибрина до 2 см в диаметре. Результат компьютерной томографии (КТ) от 03.11.2015 г. в корне определяется опухоль до 35 мм в диаметре, без четких контуров, неоднородное за счет кальцинатов.

Установлен диагноз рак корня языка T2N0M0G1 II ст. (цитологическое заключение №12234 от 20.11.2015 ― высокодифференцированный плоскоклеточный рак). Пациенту проведено 2 курса неоадъювантной полихимиотерапии (НАПХТ) по схеме DCF в курсовой дозировке Tax 100 mg, DDP 100 mg, 5Fu 5500 mg. C последующей химиолучевой терапией (ХЛТ) по радикальной программе в СОД 60 Гр.

Контрольная КТ от 19.04.2016 г. ― при контрастировании дополнительных объемных новообразований не выявлено, полная регрессия опухоли.

В августе 2016 года ухудшение состояния в виде появления боли при глотании, сукровицы в слюне. Результат ФЛС от 13.09.2016 ― в корне языка инфильтративная опухоль с полостью распада и распространением на надгортанник. При КТ шеи от 03.10.2016 ― корень языка занимает солидно-жидкостная опухоль до 50 мм в диаметре, без четких границ, с распространением на вестибулярный отдел гортани, преддверие гортани (рис. 1).

Рис. 1. Предоперационная КТ: 1 ― корень языка, 2 ― надгортанник, 3 ― подъязычная кость

Учитывая вовлечение в опухоль корня языка и вестибулярного отдела гортани (рис. 2), прогнозируемую невозможность сохранения глотательной и голосообразующей функции, низкий реабилитационный потенциал после горизонтальной резекции гортани и глоссэктомии, принято решение выполнить расширенную резекцию центрального органокомплекса шеи.

Рис. 2. Резекция ротоглотки: 1 ― корень языка, 2 ― мышцы диафрагмы полости рта

После предоперационной подготовки 12.10.2016 года выполнена операция ― трахеотомия, ларингоэктомия в блоке с глоссэктомией резекцией дна полости рта, с двусторонней лимфодиссекцией I, II, III, IV уровней. Пластика дефекта свободным желудочно-сальниковым лоскутом. Гастростомия с применением фрагмента тонкой кишки. Применение тонкой кишки в качестве вставки между желудком и брюшной стенкой было обусловлено дефицитом стенки желудка после забора висцерального лоскута. Общая продолжительность операции 11 часов 30 минут. Интраоперационная кровопотеря до 300 мл.

Пластический материал выбран инраоперационно исходя из размера дефекта тканей передней стенки глотки и дна полости рта (рис. 3), необходимостью дополнительного укрытия линии швов сальниковым лоскутом. Мышцы диафрагмы полости рта были частично сохранены и ушиты по средней линии после формирования дна полости рта и передней стенки глотки желудочным лоскутом.

Рис. 3. Общий вид операционной раны: 1 ― задняя стенка глотки, 2 ― глоточно-пищеводный переход

Источником кровообращения трансплантата были желудочно-сальниковые сосуды (рис. 4). Венозный анастомоз выполнен между веной трансплантата и внутренней яремной веной «конец-в-бок», узловыми швами полипропиленовой нитью 8-0. Артериальный анастомоз выполнен «конец-в-конец» артерии трансплантата и культи верхней щитовидной артерии, узловыми швами полипропиленовой нитью 8-0. Общее время выполнения сосудистых анастомозов 20 мин (рис. 5).

Рис. 4. Желудочно-сальниковый лоскут: 1 ― желудочно-сальниковые сосуды, 2 ― участок сальника

Рис. 5. Анастомоз с магистральными сосудами шеи: 1 ― венозный анастомоз, 2 ― артериальный анастомоз

Частичное питание через естественные пути жидкой пищей начато на 15 сутки после операции (рис. 6). Послеоперационный период без осложнений.

Рис. 6. Рентгеноскопия глотки и пищевода 

Гистологическое заключение №10332 от 18.10.2016 ― плоскоклеточный рак без признаков лечебного патоморфоза. Линии резекции без опухолевого роста. В клетчатке шеи всех уровней метастазы не выявлены.

Пациенту в сроки с 16 по 21 сутки после операции проведен курс адьювантной полихимиотерапии (АПХТ) по схеме PF в курсовой дозировке DDP 100 mg, 5Fu 5000 mg. Осложнений химиотерапевтического лечения не было. Пациент выписан на 22 сутки в удовлетворительном состоянии, без отклонения гематологических показателей. Питание при выписке частично через естественные пути, частично через гастростому, дыхание через трахеостому свободное. Желудочно-сальниковый трансплантат в полости рта жизнеспособный (рис. 7).

Рис. 7. Вид желудочного лоскута в полости рта: 1 ― переход слизистой желудка в слизистую ротоглотки

Пациенту в общей сложности проведено 4 курса АПХТ. Через 5 месяцев после операции прогрессирования опухоли нет, пациент полностью питается через естественные пути.

Клинический случай 2

Пациент П., 1961 г.р., в январе 2016 года обратился в диспансерное отделение ГБУЗ ООД г. Пензы. При ФЛС от 05.02.2016 г. в области корня языка инфильтративная опухоль без четких границ. КТ от 03.11.2015 г. ― в центральных отделах языка, корне определяется опухоль до 35 мм в диаметре, без четких контуров. Установлен диагноз рак корня языка T2N1M0G2 III ст. (Гистологическое заключение №1346 от 09.02.2016 ― высокодифференцированный плоскоклеточный рак). Проведено 3 курса НАПХТ по схеме DCF в курсовой дозировке Tax 110 mg, DDP 110 mg, 5Fu 4700 mg. C последующей ХЛТ по радикальной программе в СОД 60 Грей.

При контрольном обследовании выявлен продолженный рост опухоли. КТ от 14.11.2016 г. ― в проекции надгортанника с переходом на корень языка опухоль 34-34 мм (рис. 8). Гистологическое заключение №9867 от 04. 10.2016 ― плоскоклеточный рак.

Рис. 8. Предоперационная КТ: 1 ― корень языка, 2 ― надгортанник

Учитывая вовлечение в опухоль корня языка и вестибулярного отдела гортани, прогнозируемую невозможность сохранения глотательной и голосообразующей функции, низкий реабилитационный потенциал после горизонтальной резекции гортани и глоссэктомии, принято решение выполнить расширенную резекцию центрального органокомплекса шеи.

После предоперационной подготовки 24.11.2016 года выполнена операция ― трахеотомия, ларингоэктомия в блоке с глоссэктомией с резекцией дна полости рта, с двусторонней лимфодиссекцией I, II, III, IV уровней. Пластика дефекта свободным тонкокишечным трансплантатом. Стебельчатая гастростомия. Резекция субсерозной опухоли тела желудка (5 мм). Общая продолжительность операции 11 часов 00 минут. Интраоперационная кровопотеря до 300 мл.

Пластический материал выбран инраоперационно исходя из размера дефекта тканей передней стенки глотки и дна полости рта. Источником кровообращения трансплантата были aa. et vv. jejunalis.

Венозный анастомоз выполнен между веной трансплантата и внутренней яремной веной «конец-в-бок», узловыми швами полипропиленовой нитью 8-0. Анатомия ветвей наружной сонной артерии не позволила выполнить анастомоз с сосудами трансплантата (малый диаметр ветвей, веерообразный тип отхождений). На 2 см ниже бифуркации сонной артерии после пережатия основного ствола выполнена артериотомия, в основной ствол сонной артерии вшит участок наружной яремной вены длиной 3 см «конец-в-бок», непрерывным швом полипропиленовой нитью 8-0. Время пережатия общей сонной артерии 15 минут. Артериальный анастомоз выполнен «конец-в-конец» артерии трансплантата и участка дополнительно сформированной ветви сонной артерии, узловыми швами полипропиленовой нитью 8-0 (рис. 9). Общее время выполнения сосудистых анастомозов 35 мин. Мышцы диафрагмы полости рта были частично сохранены и ушиты по средней линии после формирования дна полости рта и передней стенки глотки тонкокишечным лоскутом.

Рис. 9. Анастомоз с магистральными сосудами шеи: 1 ― венозный анастомоз

Частичное питание через естественные пути жидкой пищей начато на 15 сутки после операции. Послеоперационный период без осложнений. Гистологическое заключение №11976 от 30.11.2016 ― плоскоклеточный рак со слабыми признаками лечебного патоморфоза. Линии резекции без опухолевого роста. В клетчатке шеи всех уровней метастазы не выявлены. Опухоль желудка ― GIST 1 степени злокачественности, Ki67 5%.

Пациент выписан на 17 сутки в удовлетворительном состоянии, без отклонения гематологических показателей. Питание при выписке частично через естественные пути, частично через гастростому, дыхание через трахеостому свободное. Тонкокишечный трансплантат в полости рта жизнеспособный (рис. 10). Через 4 месяца после операции у пациента признаков рецидива опухоли нет, питание полностью через естественные пути.

Рис. 10. Вид тонкокишечного лоскута в полости рта: 1 ― кишечный трансплантат, 2 ― часть слизистой дна полости рта

Заключение

При возникновении рецидива рака корня языка единственным возможным методом радикального лечения может быть только хирургический. Замещение обширных дефектов дна полости рта и глотки после глоссларингэктомий может быть успешно выполнено с применением свободных висцеральных лоскутов.

Литература

  1. Пачес А.И. Опухоли головы и шеи. ― 4-е издание. ― М.: Медицина, 2000. ― 480 с.
  2. Jemal A., Siegel R., Ward E. et al. Cancer statistics // CA Cancer J. Clin. ― 2009. ― Vol. 59, №4. ― P. 225-249.
  3. Чиссов В.И., Старинский В.В., Петрова Г.В. Состояние онкологической помощи населению России в 2011 году. ― М., 2012. ― 240 c.
  4. Поляков П.Ю. Возможности управления тканевой радио-чувствительностью в онкологии: дис. … докт. мед. наук. ― Обнинск, 2009. ― 302 с.
  5. Masic T., Dizdarevic D., Dizdarevic K., Lincender I. Transmandibular Approach to the Malignant Neoplasms of the Mouth Base, Tongue Root and Oropharynx // Med. Arh. ― 2009. ― Vol. 63, №5. ― P. 268-270.
  6. Геворков А.Р., Бойко А.В., Завалишина Л.Э. c соавт. Самостоятельное консервативное и комбинированное лечение рака языка // Онкология. Журнал им. П.А. Герцена. ― 2014. ― Т. 2, №4. ― С. 25-29. 

 

Онкобольные с удаленным языком смогут говорить | Статьи

Российские ученые запатентовали уникальный метод восстановления языка. Новый аутотрансплантат позволит пациенту нормально питаться и разговаривать. Операция по полному удалению языка необходима при раке третьей-четвертой стадии. До сих пор была возможна лишь очень грубая имитация органа, и многие больные отказывались от хирургического вмешательства. Ежегодно злокачественные опухоли полости рта выявляют примерно у 10 тыс. россиян.

В Московском научно-исследовательском онкологическом институте (МНИОИ) им. П.А. Герцена придумали, как восстановить удаленный из-за опухоли язык, чтобы он мог выполнять свои функции. Для этого используют собственные ткани пациента. Микрохирурги разработали аутотрансплантат, состоящий из двух фрагментов: кожно-мышечного (включает кожу, подкожную клетчатку и волокна широчайшей мышцы спины) и мышечного (это волокна передней зубчатой мышцы). У них единая сосудистая ножка. Дополнительно в аутотрансплантат включены длинный грудной и грудоспинной нервы.

Из кожно-мышечного фрагмента формируют сам язык, из мышечного — диафрагму дна полости рта. Нервы и сосуды аутотрансплантата под микроскопом с сильным оптическим увеличением сшивают с сосудами и нервами на шее. Микрохирургическая реиннервация позволяет в дальнейшем синхронизировать мышечные сокращения фрагментов и восстановить функцию глотания и речи.

— Чтобы человек мог сделать глотательное движение, язык должен заполнять объем полости рта. Во время глотка язык поднимается к нёбу, создается отрицательное давление, и пища засасывается в пищевод. Когда объем маленький, засасывающего момента не возникает. Эта сложность возникала при обычном аутотрансплантате, который был почти неподвижным и со временем уменьшался в объеме. Наш трансплантат создает слаженный глотательный механизм, — пояснил «Известиям» один из авторов новой методики заведующий отделением микрохирургии МНИОИ им. П.А. Герцена Андрей Поляков.

Есть самостоятельно и разговаривать пациентам разрешают через месяц после операции. Потом начинаются занятия с логопедом. Сколько времени потребуется на восстановление речи, зависит от конкретного случая. По словам медиков, дикция пациентов может быть хуже, чем до операции, но речь станет вполне разборчивой. И что важно: пластику языка проводят одновременно с удалением пораженного органа. За последние несколько месяцев успешно сделали 15 таких операций.

— Такие операции, как в нашем отделении микрохирургии, мало где вообще делаются, — рассказал «Известиям» гендиректор ФГБУ НМИЦ радиологии Минздрава РФ (куда входит МНИОИ) Андрей Каприн. — Нужно владеть несколькими смежными специальностями, иметь за плечами опыт большой научной школы. Методы микрохирургической аутотрансплантации тканей в отделении начали разрабатывать в 1990-х годах прошлого столетия.

Но до сих пор во всем мире язык восстанавливали в основном лоскутом кожи с подкожной клетчаткой. Главный недостаток трансплантата был в том, что он не двигался, а объем восстановленного органа со временем уменьшался. Из-за этого пациенту было трудно принимать пищу, практически невозможным становилось возвращение речи, и больные часто отказывались от лечения, предпочитая умереть с языком, а не жить с такими ограничениями.

Теперь хирургический метод медики сочетают с лучевой терапией. При таком подходе пятилетняя выживаемость пациентов с третьей и четвертой стадиями составляет 63%.

— Восстановление после таких операций проходит длительное время. Поэтому именно отдаленные результаты этих операций — в периоде двух-трехлетнего наблюдения — позволят в будущем отнести их к значимым хирургическим вмешательствам, способствующим улучшению качества жизни онкобольных, — прокомментировала работу коллег завотделением опухолей головы и шеи НМИЦ онкологии им. Н.Н. Петрова Замира Раджабова.

Ежегодно в России выявляют около 10 тыс. больных раком полости рта. 70% из них попадают к онкологам на таких стадиях, когда частичное удаление языка уже не поможет и надо полностью отсекать орган. То есть операция, разработанная МНИОИ им. П.А. Герцена, показана примерно 7 тыс. больных в год.

Плоскоклеточный рак полости рта молодеет: сейчас 24-летние пациенты с такой болезнью — уже не редкость. Женщины болеют чаще мужчин. Заболевание чаще развивается на фоне вируса папилломы человека. Одна из причин возникновения рака — потребление табака и алкоголя. Прием спиртного одновременно с курением повышает риск развития опухолей полости рта в 144 раза.

ЧИТАЙТЕ ТАКЖЕ

 

Случай рака щитовидной железы, дистопированной в корень языка | Чойнзонов

Аннотация

Чрезвычайная вариабельность формы и положения щитовидной железы обусловлена отклонениями в ее эмбриональном развитии. Специальными исследованиями показано, что приблизительно в половине случаев остатки ткани щитовидной железы обнаруживаются в области подъязычной кости, корне языка .

 

Чрезвычайная вариабельность формы и положения щитовидной железы обусловлена отклонениями в ее эмбриональном развитии. Специальными исследованиями показано, что приблизительно в половине случаев остатки ткани щитовидной железы обнаруживаются в области подъязычной кости, корне языка [1].

Клинически дистопия в корень языка определяется достаточно редко и проявляется, как правило, при развитии в железе патологических процессов. Чаще — это зоб, кистозное перерождение. Рост зоба обычно приводит к нарушению глотания, дыхания, осложняется кровотечением, зарегистрированы случаи малигнизации. Из 130 наблюдений рака языка в клиниках Онкологического научного центра РАМН рак корня языка из дистопированных остатков щитовидной железы встретился лишь у 1 больного |2). Ряд других авторов также располагают единичными наблюдениями (3—5].

Учитывая редкость данной патологии, мы считаем полезным привести собственное наблюдение.

Больная С., 28 лет, обратилась в клинику опухолей головы и шеи НИИ онкологии Томского научного центра СО РАМН 2 января 1990 г. Больная жаловалась на дискомфорт в горле при глотании, кровоточивость из корня языка, затруднение дыхания в положении лежа на спине. В 1988 г. почувствовала опухоль в области корня языка, дважды обращалась к оториноларингологу, стоматологу по месту жительства, однако они патологии не обнаружили. Дискомфорт при

■ ь

Рис. 1. Сцинтиграмма щитовидной железы.

0,5 см в диаметре. В проекции обычного расположения щитовидная железа пальпаторно не определялась. При ультразвуковом исследовании в проекции типичного расположения щитовидной железы ткани, сходной по эхогенности, не выявлено. По данным сцинтиграфии, в проекции корня языка визуализировался очаг накопления радиофармпрепарата (рис. I).

Кроме того, было трижды проведено цитологическое исследование пунктата из опухолевой ткани. Получено заключение: высокодифференцированный рак щитовидной железы.

В связи со значительными размерами опухоли было решено выполнить оперативное вмешательство наружным доступом. 8 февраля 1990 г. произведены надподъязычная фаринготомия, тиреоидэктомия с резекцией корня языка. Интубация через трахеостому. Во время трахеостомии выполнена ревизия —. щитовидная железа в месте ее обычной локализации не обнаружена. Послеоперационный период протекал без осложнений. В ранние сроки была назначена заместительная терапия тиреоидином по 0,1 г 2 раза в сутки с последующим увеличением дозы до 0,3 г/сут. Явлений паратиреоидной недостаточности не наблюдалось. При гистологическом исследовании послеоперационного материала выявлен фолликулярный рак (рис. 2).

При динамическом наблюдении в течение 3 лет общее состояние больной удовлетворительное, жалоб не предъявляет. Данных, указывающих на рецидив опухоли и метастазирование, не получено. Больной проводится заместительная терапия тиреоидными препаратами. Социальная и трудовая реабилитация полная.

Очаг накопления радиофармпрепарата определяется в проекции корня языка и отсутствует в месте типичного расположения щитовидной железы.

Рис. 2. Полученная морфологическая картина фолликулярного рака при исследовании послеоперационного материала.

Окраска гематоксилином и эозином. Ув. 120.

глотании, затруднение дыхания, кровоточивость из опухоли усилились, что побудило больную уже в 3-й раз обратиться к оториноларингологу в 1989 г. После проведенного обследования в онкологическом диспансере по месту жительства был поставлен диагноз «аберрантный зоб корня языка (?)», и больная направлена в НИИ онкологии Томского научного центра СО РАМН.

При поступлении пальпаторно шейные лимфоузлы не определялись. Открытие рта в полном объеме. В толще корня языка пальпируется опухоль 5X4 см плотноэластической консистенции, покрытая нормальной слизистой с участком эрозии до

1. Валдина Е. А., Пучков Ю. Г. // Вопр. онкол — 1975.—№ 3 — С. 16-18.

2. Матякин Е. Г., Алферов В С., Федорова Е. Н. // Стоматология,— 1981,— № 4,— С. 71.

3. Михайлов Ю. М., Димова М. Н’. // Хирургия.— 1981.—№ 6,— С. 95-96.

4. Пропп Р. М. // Там же.— 1964.— № 12.— С. 122-123.

5. Пропп Р. М., Фалилеев Г В.. Заридзе Д. Г // Там же,—1974,— № 1,— С. 44-47.


Факты о раке полости рта

Что такое рак полости рта?


   Рак ротовой полости – это атипичное разрастание клеток в тканях ротовой полости. Такие процессы могут затрагивать губы, язык, ротоглотку. 
   Существует два вида ракового поражения ротовой полости: рак, развивающийся непосредственно во рту, на слизистой оболочке щек, неба, языка, десен и губ(называемый раком полости рта и губ), и рак, развивающийся в глубине ротовой полости в области миндалин, именуемый раком ротоглотки.


Насколько распространен рак ротовой полости?


   Согласно статистике раком ротовой полости ежегодно заболевают 13500 жителей России.

Каковы факторы риска развития рака ротовой полости?

 

Табакокурение в любом виде, жевание табака и систематическое употребление алкоголя – вот наиболее значимые факторы риска развития рака ротовой полости.

Раннее леченный рак ротовой полости, наследственная предрасположенность (наличие онкологического заболевания ротовой полости в роду) и возраст старше 40 лет также сильно увеличивают риск развития рака ротовой полости.

Носительство Вируса Папилломы Человека, (вируса, вызывающего рак шейки матки у женщин) известного как ВПЧ (HPV) 16 является серьезным фактором риска развития онкологического поражения ротовой полости, также как и носительство Вируса простого герпеса (HSV-1).

Еще одним фактором риска является кандидоз, а также солнечный свет. (Ультрафиолетовое излучение по результатам исследований вызывает рак красной каймы губ).

Но!!! 25% пациентов имеющих рак ротовой полости не имели ни одного (!) фактора риска развития онкологического заболевания.

 

Возможные факторы риска развития рака слизистой оболочки полости рта

Раздражение и высыпания вокруг губ

Некоторых беспокоит, что длительные раздражения подобного рода могут привести к развитию раковой опухоли. В частности, не должным образом подогнанные зубные протезы могут вызвать раздражение слизистой. Необходимо проходить профилактический осмотр у стоматолога, как минимум, 1 раз в год.

Гигиена полости рта

Исследования доказывают, что люди, редко посещающие стоматолога и чистящие зубы не более одного раза в день, подвергаются большему риску заболевания раком слизистой оболочки полости рта.

Семейная история заболевания

Предполагают, что большему риску подвергаются те, у кого есть близкий родственник с подобным заболеванием.

Шаги, которые помогут вам предотвратить появление и развитие рака ротовой полости:

    Не курите и не используйте какие-либо табачные изделия (нюхательный или жевательный табак), не злоупотребляйте алкоголем.

    Питайтесь по хорошо сбалансированной диете.

    Ограничьте пребывание на солнце. Чрезмерное пребывание на солнце повышает риск развитие рака нижней губы. Используйте солнцезащитные крема и бальзамы для губ.

Кроме того, занимайтесь самообследованием хотя бы раз в месяц. Используйте зеркало и яркий свет, обследуйте ротовую полость, горло, губы, зубы и десны на наличие подозрительных симптомов, перечисленных ниже. Если вы заметили что-то подозрительное, немедленно обратитесь к врачу. Не игнорируйте регулярное посещение стоматолога.

К симптомам рака полости рта относят следующее:

  • Кровоточащая ранка во рту, которая долго не заживает
  • Изменение цвета десен
  • Шишки, наросты, уплотнения белесоватые пятна во рту
  • Боли локального характера или иррадиируюшие в висок, ухо
  • Онемение, повышенная чувствительность в зоне поражения
  • Повышенное слюноотделение
  • Неприятный запах изо рта
  • Проблемы с зубами
  • Трудности при глотании, жевание, приеме пищи
  • Припухлости, утолщение щеки
  • Потеря веса
  • Изменение голоса
  • Припухлости на шее
  • Затруднение дыхания

 

 

СТАТИСТИЧЕСКИЕ ДАННЫЕ

—  Более 13500 случаев заболевания раком полости рта и губ регистрируется в России ежегодно.
—  Почти 37 человек в день! в России узнают свой страшный диагноз – рак полости рта.
—  78% всех случаев заболевания раком полости рта и губ в России диагностируется на III-IV клинических стадиях, среди таких пациентов коэффициент выживаемости не превышает 5 лет.Если поставлен диагноз рака полости рта без метастазов, то 82% этих больных уверенно живут более 5 лет, а если уже есть метастазы, то лишь 28% таких больных живут более 5 лет.
—  Исследования ОнкоцентраJohnHopkins (США) и других медицинских учреждений показывают, что Вирус Папилломы Человека (HPV) 16, передаваемый половым путем (в том числе через поцелуи), является причиной возникновения рака полости рта и губ, преимущественно глотки и корня языка.
—  Риск развития рака полости рта у мужчин в 6 — 8 раз,превышает аналогичны риск у женщин.
—  Лица в возрасте 65 лет и старше с наличием одного или нескольких факторов риска развития рака ротовой полости находятся в группе наивысшего риска.
—  25% жертв рака полости рта и губ не курят, не употребляют алкоголь систематически и не имеют прочих факторов риска.
—  Выявление начальной стадии рака полости рта дает большой шанс излечить болезнь.

 

При подготовке статьи использованы материалы сайтов http://putimplant.ru/p0042.htmhttp://health.obozrevatel.com/diseases/42135-rak-rotovoj-polosti.htm

Какая связь между раком языка, Майклом Дугласом, и оральным…

Доктор Ави Хефец, старший хирург и заведующий отделением хирургии и онкологии головы и шеи центра A.Р.М. при больнице «Ассута Тель-Авив», попытается объяснить существует ли связь между раком языка и оральным сексом, в свете недавнего визита в Израиль голливудского актёра Майкла Дугласа. Дуглас приехал чтобы отпраздновать бар-мицву (религиозное совершеннолетие) сына. В 2013 году Дуглас публично объявил, что страдал карциномой горла, и спустя несколько месяцев уточнил, что на самом деле это был рак языка. Почему ему стыдно было рассказать об этом заболевании? Может потому, что, по словам актёра, его болезнь связана с оральным сексом?

Признаки и причины заболевания

Наиболее распространённой формой рака полости рта является плоскоклеточный рак, известный под сокращением SCC (squamous cell carcinoma). Основными установленными причинами развития данного вида рака являются курение сигарет или трубки, жевательный табак и употребление алкоголя. Вопреки распространённому мнению, потребление алкогольных напитков не дезинфицирует полость рта. Алкоголь, также как сигаретный дым содержит канцерогенные вещества, когда разные канцерогены объединяются, они намного более вредны, чем каждый по отдельности, и поэтому человек, имеющий обыкновение потреблять табак и алкоголь подвергается многократному риску развития рака ротовой полости из-за синергетического эффекта.

Рак языка и ВПЧ

Недавно установлено, что распространённость рака языка и глотки находится в зависимости с заражением вирусом папилломы человека (ВПЧ), который в свою очередь зависит от частоты орального секса, особенно когда речь идёт о множестве партнёров. Вирус папилломы человека, более известный как фактор, повышающий риск развития рака шейки матки, недавно определён и как распространённая причина развития рака языка и глотки. Инфекция напрямую передаётся во время орального секса. Установлено, что с увеличением числа партнёров и числа половых отношений возрастает количество случаев инфицирования вирусом, и в связи с этим – увеличивается частота возникновения опухолей языка и глотки.

Основными признаками, которые могут указывать на начало развития рака глотки, являются уплотнение или язва во рту, которые иногда сопровождает болевой эффект. Если рак поражает основание языка, то это вызывает значительные трудности при глотании; если поражает десны — то вызывает расшатывание зубов. Кроме того, бывают ситуации, в которых поражение проявляется в виде белой или красной слизистой оболочки, покрывающей полость рта. В общем случае, если поражения не проходят в течение двух — трёх недель, рекомендуется посетить ЛОР специалиста. Если опухоль на ранней стадии не обнаружена, она имеет тенденцию распространяться на лимфатические узлы в области шеи. Опухание желёз в течение длительного периода может быть дополнительным признаком развития заболевания. Чем больше проходит времени, тем легче выявить опухоль, но возрастает риск начала развития метастазирования. Опухоль начинается с размера менее 1 см и может достигнуть внушительных размеров.

Диагностика

Диагностика опухоли проводится под общим наркозом при помощи биопсии. При опухоли корня языка очень важно проверить также наличие вируса папилломы (ВПЧ) в раковых клетках, потому что это влияет на выбор тактики лечения. Кроме биопсии и физического осмотра врачом, проводятся диагностические визуальные тесты, такие как КТ или МРТ.

Лечение

Лечение рака в ротовой полости проводится в два этапа: хирургическое лечение (операция по удалению опухоли) и дополнительные лечебные мероприятия (облучение; в отдельных случаях инъекции химиотерапии).

Хирургическое лечение

Предназначено для удаления раковой опухоли. с помощью усовершенствованного скальпеля, работающего на высоких частотах. Во время операции проводится частичное или полное удаление. Частичная резекция позволяет пациенту после операции полностью восстановить речь и функцию глотания.

Инновационным методом является реконструкция языка с помощью «свободного лоскута», в случаях, когда проводится полная резекция языка. Лоскут ткани берётся из предплечья и соединяется с вырезанной областью, а кровеносные сосуды, которые обеспечивают это соединение, соединяются с кровеносными сосудами в области шеи так же, как и при трансплантации. Данная хирургическая опция позволяет быстро вернуть утраченные во время операции функции.

Лучевая терапия

Назначается пациентам с прогрессирующей стадией заболевания или больных с опухолями, расположенными у основания языка, миндалин и гортани. Некоторыми из побочных эффектов облучения являются сухость во рту и увеличение кариеса, лечение зубов может привести к разрушению костной ткани челюсти. Для пациентов с опухолями в задней части языка (в основании языка) вариант облучения и химиотерапии является более предпочтительным, чем операция. Данный вид рака часто встречается у пациентов, инфицированных вирусом папилломы человека.

Реабилитация

Продолжительность реабилитации пациента, с момента операции и до возвращения к нормальному функционированию языка и гортани, занимает от нескольких недель до нескольких месяцев. Подобно опухолям других органов, раннее обнаружение значительно повышает шансы на выздоровление. Заболевание принято разделять на четыре стадии (стадия I, II, III, IV), чем выше стадия заболевание, тем ниже шанс на выздоровление. На первой стадии (ранней) шанс излечения более 90%, и этот процент снижается до уровня ниже 50% на более поздних стадиях. У 10% — 20% пациентов развивается вторичная опухоль (в совершенно другом органе, например, рак толстой кишки), вероятность развития вторичной опухоли выше у пациентов, продолжающих курить. Следует отметить, что пациенты, у которых обнаружен вирус папилломы (ВПЧ), лучше реагируют на облучение, и они лучше восстанавливаются после болезни, чем остальная часть пациентов.

Эстетика

Основное различие между лечением рака полости рта и лечением злокачественного новообразования в других органах заключается в возможных последствиях, оказывающих влияние на внешний вид пациента. В отличие от внутренних органов, при раке ротовой полости хирургическое вмешательство является очевидным. Иногда операция приводит к искажению лица, и тогда важно психологически подготовить пациента к изменению внешности.

И, конечно же: Майкл Дуглас

Действительно, в одном из интервью назад Майкл Дуглас утверждал, что у него рак горла, а не языка, потому что он боялся того, что хирургическое вмешательство может привести к деформации лица…

Рак языка: симптомы, изображения и перспективы

Рак языка — это разновидность рака ротовой полости, которая обычно развивается в плоскоклеточных клетках на поверхности языка. Это может вызвать опухоли или поражения. Наиболее заметные признаки рака языка — это не заживающая язва на языке и болезненный язык.

Рак может развиваться в двух разных частях языка. Рак языка развивается в передней части языка, а рак задней части языка известен как рак ротоглотки.

Симптомы рака полости рта могут включать:

  • красные или красно-белые пятна (лейкоплакия полости рта), которые появляются на слизистой оболочке рта или языка
  • язвы и язвы во рту, которые не заживают
  • ангина или боль при глотании
  • ощущение, что что-то застряло в горле
  • болезненный язык
  • хриплый голос
  • затрудненное движение челюстью или языком
  • боль в шее или ухе
  • шатающиеся зубы
  • припухлость в оставшейся области более трех 3 недель
  • шишка во рту
  • утолщение слизистой оболочки рта
  • зубные протезы, которые больше не подходят правильно

Многие из ранних признаков рака полости рта трудно обнаружить, поэтому люди могут не замечать никаких признаков или симптомов при первоначальном развитии рака.

Людям, которые более подвержены риску рака ротовой полости, например, тем, кто много курит или злоупотребляет алкоголем, следует проявлять бдительность в отношении любых ранних признаков. Им также следует регулярно посещать врача или стоматолога, который может осмотреть их рот и выявить любые проблемы.

Самый распространенный вид рака языка называется плоскоклеточной карциномой. Плоские клетки — это тонкие плоские клетки, которые присутствуют на поверхности кожи и языка, в слизистой оболочке пищеварительного и дыхательного трактов, а также в слизистой оболочке рта, горла, щитовидной железы и гортани.

Основными симптомами рака языка являются болезненность языка и развитие язвы на языке. Дополнительные симптомы могут включать:

  • боль в челюсти или горле
  • боль при глотании
  • ощущение, будто что-то застревает в горле
  • жесткий язык или челюсть
  • проблемы с глотанием или жеванием пищи
  • красный или белый пластырь, образующийся на слизистой оболочке рта или языка
  • язва языка, которая не заживает
  • онемение во рту
  • кровотечение из языка без причины
  • комок на языке, который не проходит

Симптомы рака языка аналогичны таковым при других формах рака полости рта, и они также могут не проявляться на ранних стадиях заболевания.

Люди также могут иметь некоторые из этих симптомов без рака языка или другого типа рака полости рта.

Врачи классифицируют большинство типов рака по стадиям в зависимости от степени распространенности рака и от того, распространился ли он или метастазировал в другие части тела.

В системе классификации используются буквы и цифры. Буква T указывает на опухоль, а буква N относится к шейным лимфатическим узлам. Каждой из этих букв присвоена оценка от 1 до 4 или от 0 до 3 соответственно.

Люди с опухолью Т1 имеют самую низкую степень опухоли, в то время как люди с опухолью Т4 имеют самую большую степень.

Классификация N0 означает, что рак языка не распространился на лимфатические узлы шеи. Рак языка, распространившийся на значительное количество лимфатических узлов, имеет классификацию N3.

Также можно классифицировать рак языка следующими способами:

  • низкая степень
  • умеренная
  • высокая степень

Эта оценка показывает, насколько агрессивно растет рак и насколько вероятно его распространение на другие части тело.

Специалисты не до конца понимают, почему у некоторых людей развивается рак языка. Однако определенные факторы риска могут увеличить вероятность развития этого заболевания.

Известные факторы риска включают:

  • курение или жевание табака
  • чрезмерное употребление алкоголя
  • соблюдение диеты с низким содержанием фруктов и овощей и высоким содержанием красного мяса или обработанных пищевых продуктов
  • инфицирование вирусом папилломы человека (ВПЧ)
  • наличие в семейном анамнезе рака языка или рта
  • , ранее имевших рак, особенно плоскоклеточный рак

Пожилые мужчины являются группой, наиболее подверженной риску рака языка.Рак полости рта чаще всего встречается у людей в возрасте 50 лет и старше.

У курильщиков, которые также много пьют, вероятность развития рака полости рта в 15 раз выше, чем у других людей.

Дополнительные факторы риска включают:

  • гастроэзофагеальная рефлюксная болезнь (ГЭРБ)
  • жевание бетеля, обычная привычка в Юго-Восточной Азии
  • воздействие определенных химических веществ, включая асбест, серную кислоту и формальдегид
  • плохая гигиена полости рта или другие факторы поражающие ротовую полость, например, зазубренные зубы, вызывающие раздражение, или неподходящие зубные протезы

Любой, кто обеспокоен тем, что у него может быть рак языка, должен как можно скорее записаться на прием к врачу.

На приеме врач, скорее всего, потратит время:

  • , спросив о любом соответствующем медицинском анамнезе, включая семейный анамнез
  • осмотр языка и рта
  • осмотр лимфатических узлов на предмет увеличения

Если врач подозревает рак языка, он выполнит биопсию. Это будет включать в себя удаление части ткани и отправку ее на тестирование.

Если результаты биопсии подтверждают наличие рака, врач может порекомендовать компьютерную томографию или МРТ, которые покажут, распространился ли рак на другие части тела.

Рак языка можно вылечить, и перспективы лучше у людей, которым поставлен ранний диагноз. Люди, у которых не распространился рак, имеют более высокий уровень выживаемости.

5-летняя относительная выживаемость при раке языка составляет 78 процентов до того, как рак распространится, по сравнению с 36 процентами после его распространения.


Отказ от курения может снизить риск развития рака языка.

Невозможно предотвратить развитие рака языка.Однако, если люди замечают какие-либо признаки или симптомы рака языка, им следует как можно скорее записаться на прием к врачу. Чем раньше врач диагностирует заболевание, тем раньше можно начать лечение и тем более благоприятным будет прогноз.

Существуют также факторы образа жизни, которые люди могут контролировать, чтобы минимизировать риск развития рака языка. К ним относятся:

  • отказ от курения
  • отказ от жевания табачных изделий или бетеля
  • ограничение или полное прекращение употребления алкоголя
  • разнообразное, здоровое питание, включающее много фруктов и овощей
  • соблюдение правил гигиены полости рта с помощью чистки зубов щеткой и зубной нитью регулярное посещение стоматолога
  • получение полного курса вакцины против ВПЧ
  • безопасный секс и использование зубной прокладки для орального секса

Людям с раком языка обычно требуется операция по удалению раковой ткани.Как правило, хирурги могут удалить опухоли меньшего размера за одну операцию.

При наличии больших опухолей или при распространившемся раке могут потребоваться множественные и более сложные операции. Хирургу также может потребоваться удалить часть языка. В этом случае они попытаются восстановить язык, используя кожу или ткани других частей тела.

Операция, включающая удаление части или всего языка, называется глоссэктомией. Хотя врачи постараются свести к минимуму повреждение ротовой полости во время процедуры, некоторые побочные эффекты неизбежны.

Глоссэктомия может повлиять на:

  • речь
  • прием пищи
  • дыхание
  • глотание

Помимо хирургического вмешательства, некоторые люди могут пройти лучевую или химиотерапевтическую терапию, чтобы убить оставшиеся раковые клетки.

Прогноз для человека с раком языка зависит от его стадии на момент постановки диагноза и успеха лечения.

По статистике, 83,7 процента людей с раком полости рта или глотки 1 стадии доживают до 5 лет и более.Для сравнения: 39,1 процента людей, у которых распространился рак.

Прочтите статью на испанском языке.

Рак языка: причины, диагностика и лечение

Это один из нескольких видов рака полости рта. Как и другие виды рака, это происходит, когда клетки бесконтрольно делятся и образуют рост или опухоль.

Есть два типа. Один из них называется раком ротового языка, потому что он влияет на ту часть, которую вы можете высунуть. Другой — у основания языка, где он соединяется с горлом.Этот тип, называемый раком ротоглотки, часто диагностируется после того, как он распространился на лимфатические узлы на шее.

Рак языка встречается реже, чем многие другие типы. Большинство людей, которые заболевают, — это пожилые люди. У детей встречается редко.

Симптомы

Одним из первых признаков рака языка является опухоль или язвочка на боковой стороне языка, которая не проходит. Может быть розовато-красного цвета. Иногда язва будет кровоточить, если вы прикоснетесь к ней или укусите ее.

У вас также могут быть:

  • Боль в языке или около него
  • Изменения вашего голоса, например, хриплый звук
  • Проблемы с глотанием
Продолжение

Если у вас болит язык или во рту, но не через пару недель не станет лучше, обратитесь к врачу.

Если проблема в основании языка, вы можете не заметить никаких симптомов. Ваш стоматолог может обнаружить признаки рака языка во время осмотра, или ваш врач может что-то заметить во время обычного осмотра.

Причины

Вирус папилломы человека (ВПЧ) может вызывать рак у основания языка. ВПЧ также может инфицировать область половых органов и вызывать рак шейки матки, рак полового члена и рак анального канала. Это самая распространенная инфекция, передающаяся половым путем. Есть много типов ВПЧ.Те, которые повышают ваши шансы заболеть раком, называются ВПЧ высокого риска.

Другие факторы, которые могут повысить ваши шансы заболеть раком языка, включают:

  • Употребление табака
  • Употребление алкоголя
  • Неровные зубы
  • Отсутствие заботы о зубах и деснах

Ваши гены также могут играть роль в том, будут ли вы, вероятно, заболеете раком языка.

Диагноз

Врач осмотрит ваш рот и задаст вопросы о ваших симптомах.Они могут порекомендовать рентгеновское сканирование или компьютерную томографию (компьютерная томография) — несколько рентгеновских снимков берутся под разными углами и собираются вместе, чтобы показать более детальное изображение.

Они также могут взять образец ткани изо рта для анализа (биопсия).

Лечение

Ваше лечение будет зависеть от того, где находится ваша опухоль и насколько она велика.

Операция часто является лучшим способом удалить опухоль с той части языка, которую вы видите. Ваш врач, вероятно, извлечет часть здоровой ткани и близлежащие лимфатические узлы, чтобы убедиться, что весь рак исчез.

Если рак находится на задней части вашего языка, вам может быть назначена лучевая терапия (рентгеновские лучи и другие виды излучения). Иногда лучшим лечением является комбинация химиотерапии или противораковых препаратов и радиации.

Позже вам может потребоваться терапия, которая поможет вам жевать, двигать языком, глотать и лучше говорить.

Вам нужно будет регулярно проходить осмотры, чтобы убедиться, что рак не вернулся.

Профилактика

Мы знаем, что многие случаи рака основания языка вызваны ВПЧ.Вот некоторые факторы, которые могут снизить вероятность заболевания этим типом рака:

  • Пройдите вакцинацию от ВПЧ, в зависимости от вашего возраста. Поговорите со своим врачом о возможных вариантах.
  • Если вы ведете половую жизнь, пользуйтесь латексными презервативами каждый раз, когда занимаетесь сексом.
  • Не употребляйте табак ни в какой форме.
  • Избегайте чрезмерного или частого употребления алкоголя.
  • Позаботьтесь о зубах и деснах.

Выявление симптомов рака языка | Colgate®

Произнесите слово «рак», и большинство людей вспомнят самые известные заболевания: легкие, толстую кишку, кожу и тому подобное.Хотя рак ротовой полости — особенно рак языка — имеет тенденцию быть второстепенным, язык играет решающую роль в еде и разговоре. Поэтому так же важно знать, что искать в симптомах рака языка, чтобы здоровье полости рта не угрожало этим основным функциям.

Что такое рак языка?

Язык разделен на две части. Передние две трети — это оральный язык, а задняя треть — это основание языка.Рак языка — это разновидность рака, которая начинается внутри клеток языка. Это может привести к повреждению или опухоли на языке. Этот тип рака может возникать на передней части вашего языка и известен как рак языка полости рта.

Кроме того, он может развиваться в нижней части языка, рядом с тем местом, где он держится под вашим ртом. Рак может поражать мягкое небо, боковые и заднюю стенки глотки, а также заднюю треть языка. Это называется раком ротоглотки.

Самым известным видом рака языка является плоскоклеточный рак. Этот рак проявляется:

  • внутри слизистой оболочки пищеварительного и дыхательного трактов
  • внутри слизистой оболочки горла, щитовидной железы, гортани, носа и рта
  • на поверхности кожи

Этот рак обычно возникает из тонких плоских клеток, известных как плоскоклеточные клетки, которые полностью покрывают поверхность языка. Любой рак, развивающийся на основании языка, известен как рак ротоглотки.

Симптомы рака языка

Люди часто путают рак полости рта с менее серьезными заболеваниями, такими как язвы во рту или зубная боль. Если симптомы не исчезнут, обратитесь к врачу. Врач может порекомендовать сделать тесты, чтобы узнать, есть ли у вас рак языка. Симптомы включают:

  • изменение голоса
  • затруднения при жевании или глотании
  • красное или белое пятно на миндалинах, языке, деснах или слизистой оболочке рта
  • утолщение или шишка на щеке
  • боль во рту, которая не проходит
  • боль в челюсти или зубах

Выявление рака языка

Очень важно проходить 6 ежемесячных осмотров у стоматолога, поскольку он / она будет проверять ранние признаки рака полости рта.Однако, если вы заметили один или несколько симптомов, указывающих на рак языка, пожалуйста, немедленно обратитесь к своему стоматологу . Первый шаг, который предпримет ваш стоматолог, — это пройти базовое обследование полости рта. Для постановки правильного диагноза задействованы многочисленные области, но язык, горло, щеки, верхняя и нижняя части рта и лимфатические узлы шеи должны пройти тщательное обследование. Если врач обнаружит необъяснимый рост в полости рта, он / она в конечном итоге сделает биопсию щеткой или ткани.

Другие методы обнаружения должны выполняться врачом при необходимости. Например, эндоскопию можно использовать для более детального изучения горла и легких. Рентген челюстей, грудной клетки и легких покажет, распространился ли рак из языка, тогда как компьютерная томография выявит любые потенциально злокачественные опухоли. Как и рентген, МРТ помогает определить, действительно ли рак подвергся метастазированию, заразив другую часть тела. Если ваш врач не может определить причину ваших симптомов, он может направить вас к специалисту по уху, носу и горлу.

Методы лечения

Ключом к лечению любой формы рака является его раннее обнаружение, до того, как он распространится. В частности, при раке языка существует несколько подходов к лечению в зависимости от размера инфекции и от того, попала ли она в лимфатические узлы шеи. Небольшие изолированные опухоли удаляются хирургическим путем. Рак, который распространился на эти лимфатические узлы, должен получать такое же лечение, если за ним следует сеанс лучевой терапии для уничтожения оставшихся клеток.Конечно, химиотерапия — это еще один вариант лечения, который вы можете обсудить со своим лечащим врачом.

Любая форма рака должна рассматриваться как опасное для жизни состояние, и поэтому она заслуживает наилучшего медицинского обслуживания, чтобы ваш курс лечения был идеальным для вас. Тем не менее, лучший способ избежать этих симптомов рака языка — это вести максимально здоровый образ жизни. При раке языка это включает в себя соблюдение режима гигиены полости рта, который не только избегает табачных изделий, но и сохраняет ваши зубы и язык здоровыми благодаря правильному уходу за полостью рта.

Хронический пародонтит и риск рака языка | Рак головы и шеи | JAMA Отоларингология — хирургия головы и шеи

Цель Оценить связь между хроническим периодонтитом в анамнезе и риском рака языка.

Дизайн Исследование случай-контроль с использованием ранее существовавших данных пациентов, поступивших в период с 15 июня 1999 г. по 17 ноября 2005 г.

Настройка Отделение стоматологии и челюстно-лицевого протезирования в Институте рака Розуэлл-Парк (RPCI), Буффало, штат Нью-Йорк.

Пациенты В число случаев вошли 51 белый мужчина неиспаноязычного происхождения, у которого впервые была диагностирована первичная плоскоклеточная карцинома языка, и контрольная группа, 54 белых мужчины неиспаноязычного происхождения, обследованные за тот же период, но с отрицательными результатами на злокачественность. Дети (в возрасте <21 года), беззубые пациенты или пациенты с ослабленным иммунитетом, а также те, у кого в анамнезе был какой-либо рак, были исключены. История пародонтита оценивалась по потере альвеолярной кости, измеренной на панорамных рентгенограммах одним исследователем, слепым к статусу рака.

Основная мера результата Заболеваемость раком языка получена из реестра опухолей RPCI.

Результаты После поправки на влияние возраста на момент постановки диагноза, статуса курения и количества зубов, каждый миллиметр потери альвеолярной кости был связан с 5,23-кратным увеличением риска рака языка (отношение шансов, 5,23; 95% доверительный интервал, 2,64). -10,35).

Выводы Это исследование предполагает связь между хроническим пародонтитом и риском рака языка у мужчин, независимо от статуса курения, возраста, расы, этнической принадлежности и количества зубов.Эту связь необходимо подтвердить более крупными исследованиями с использованием количественной оценки воздействия табака на протяжении всей жизни. Если эта связь подтверждена, это может иметь потенциальное влияние на понимание этиологии рака полости рта, а также на его профилактику и контроль.

Американское онкологическое общество оценило 30 990 новых случаев рака полости рта и 7320 случаев смерти от этих видов рака в 2006 году. 1 Около 50% тех, кому поставлен диагноз в этом году, умрут в течение 5 лет. Из-за хорошо известного феномена «полевого рака» в области головы и шеи у людей с первичными опухолями ротовой полости и глотки также выше вероятность развития рака пищевода, гортани, легких и желудка.Кроме того, пациенты с раком полости рта часто имеют множественные первичные поражения и имеют до 20 раз повышенный риск развития второго первичного рака полости рта. 2

Мрачная статистика заболеваемости раком полости рта и выживаемости за последние 3 десятилетия практически не изменилась, несмотря на доступность полости рта для прямого обследования, профилактические меры против известных факторов риска рака полости рта и достижения в лечении и диагностике, что убедительно свидетельствует в пользу новые подходы. 3 Необходимы новые взгляды на этиологию и стратегии профилактики.

Значительные доказательства указывают на то, что хронические инфекции и стойкое воспаление связаны с повышенным риском рака. 4 Хотя вирусные инфекции связаны с канцерогенезом, доказательства связи между бактериальными инфекциями и канцерогенезом также убедительны. 5 Helicobacter pylori инфекция при раке желудка, 6 Chlamydia pneumonia инфекция при раке легких 7 Streptococcus bovis инфекция при раке толстой кишки, 8 инфекция Salmonella typhi и при гепатобилиарной карциноме 10 — несколько примеров.

Пародонтит — хроническая инфекция полости рта, причиной которой являются грамотрицательные анаэробные бактерии в зубной биопленке. 11 Однако недавние данные также свидетельствуют о значительной роли вирусов в инициации и прогрессировании пародонтита. Пародонтальные бактерии и вирусы могут действовать синергетически, вызывая пародонтит. 12 Что еще интереснее, исследования показывают, что пародонтальные карманы действуют как резервуары для вируса папилломы человека (ВПЧ), цитомегаловируса 13 и вируса Эпштейна-Барра, 14 подозреваемых агентов, связанных с раком полости рта.Пародонтит, характеризующийся пролиферацией и миграцией эпителия, приводит к хроническому высвобождению воспалительных цитокинов, хемокинов, простагландинов, факторов роста и ферментов, которые также тесно связаны с канцерогенезом. 11

Таким образом, существенные доказательства подтверждают связь между хроническими инфекциями и повышенным риском рака. Специфическая связь между хроническим пародонтитом и раком полости рта вполне вероятна и требует изучения.Целью этого исследования было оценить связь между историей пародонтита и риском рака языка.

Дизайн исследования и популяция

Был использован дизайн исследования случай-контроль. Исследуемая популяция состояла из пациентов, осматривавшихся в отделении стоматологии и челюстно-лицевого протезирования в Институте рака Розуэлл-Парк (RPCI), Буффало, штат Нью-Йорк, в период с 15 июня 1999 г. по 17 ноября 2005 г.Отделение предоставляет полный спектр стоматологических услуг, включая плановую профилактику, реставрацию, реабилитацию полного рта, зубные имплантаты, хирургические процедуры полости рта и челюстно-лицевое протезирование рака, а также здоровых пациентов с широким диапазоном возраста и социально-экономического статуса. Для доступа к медицинским записям в RPCI было получено одобрение институционального наблюдательного совета на существующий обзор данных и отказ от Закона о переносимости и подотчетности медицинского страхования для использования и раскрытия защищенной медицинской информации в исследованиях.

Для настоящего анализа мы ограничили исследуемую популяцию белыми мужчинами неиспаноязычного происхождения. Дети (в возрасте <21 года), беззубые пациенты и пациенты с любыми видами рака в анамнезе, лечением рака, дисплазией полости рта, иммунодефицитом и аутоиммунными расстройствами были исключены.

Определение случаев и контроля

Все белые мужчины неиспаноязычного происхождения с первичным плоскоклеточным раком языка ( Международная классификация онкологических заболеваний [ ICD-O ] код C01.0-C02.9), диагностированный в период с 15 июня 1999 г. по 17 ноября 2005 г., были включены как случаи заболевания. Диагнозы случаев рака были получены из реестра опухолей RPCI.

Все белые мужчины неиспаноязычного происхождения, наблюдавшиеся в отделении в течение того же периода, что и заболевшие, но у которых не был диагностирован рак или дисплазия полости рта, были включены в качестве контроля. Диагнозы контрольной группы были получены из больничной информационной системы RPCI.

Оценка и определение пародонтита

История пародонтита оценивалась по степени потери альвеолярной кости (ABL) на панорамных рентгенограммах.Они были получены с помощью ортопантомографа с программным управлением (OP100; Instrumentarium Imaging, Туусула, Финляндия) с использованием стандартного времени экспозиции (17,6 секунды) и настроек (70 кВ [пик] и 12 мА). Положение пациента было стандартизировано с помощью осветительных приборов, опор для головы, висков и подбородка, клавиш регулировки окклюзии и прикусной вилки. Пленки были проявлены с помощью автоматического пленочного процессора.

Потеря альвеолярной кости, установленный показатель периодонтита в анамнезе, позволяет количественно оценить кумулятивную вертикальную потерю кости.Потеря альвеолярной кости измерялась на мезиальном и дистальном участках всех зубов с помощью интерактивной программы с оператором. Программа позволяет измерять расстояние от цементно-эмалевого соединения до гребня кости по линии, параллельной длинной оси зуба (рисунок). Радиографические изображения захватываются цифровой системой визуализации. Миллиметровая сетка используется для преобразования размеров изображения из пикселя в миллиметр. Как правило, ABL менее 2 мм считается нормальным или здоровым пародонтом. 15

Точность и надежность измерений ABL с использованием этого метода были установлены ранее. 15 В настоящем исследовании все измерения ABL проводились 1 обученным пародонтологом. Экзаменатор не знал о онкологическом статусе пациентов. Повторные измерения ABL были выполнены у 5 испытуемых с 3-дневным интервалом, чтобы установить надежность внутриэкспертизы. Среднее значение ± стандартное отклонение разницы повторных измерений составило 0,22 ± 0,41 мм.

Для выбора и определения ковариант мы были ограничены информацией, доступной в существующих картах пациентов.Информация о курении сигарет, трубки или сигары (никогда, бывшее, нынешнее), возрасте на момент постановки диагноза (лет), поле (мужчины и женщины), расе (белый, черный, азиат, коренной американец / аляска, житель Гавайев / островов Тихого океана, и др.), а также этническая принадлежность (латиноамериканцы и неиспаноязычные) были доступны в электронном виде из Информационной системы больниц RPCI. Информация о количестве имеющихся естественных зубов (непрерывных), количестве зубов с полостями (непрерывных), пломбах (непрерывных), коронках (непрерывных) и эндодонтическом лечении (непрерывных) была получена с помощью рентгенограмм.

Средние значения, стандартные отклонения, частоты и пропорции доступных релевантных переменных были использованы для описания исследуемой популяции. Для сравнения случаев рака и контроля на сходство использовались тесты χ 2 и t (непарные и двусторонние). Независимый эффект ABL на риск рака языка был оценен с помощью множественных анализов логистической регрессии после корректировки эффектов искажающих факторов. Были рассчитаны отношения шансов (OR) и их 95% доверительные интервалы (CI).Для анализа данных использовали статистическое программное обеспечение SPSS версии 12.0 (SPSS Inc, Чикаго, Иллинойс).

Таблица 1 описывает исследуемую популяцию. Возраст и статус курения среди больных и контрольной группы достоверно не различались. Среднее значение ABL было значительно выше в случаях рака по сравнению с контрольной группой (4,21 против 2,74 мм; P <0,001). Остальные оральные переменные существенно не различались между случаями и контролем.

После поправки на возраст, статус курения и количество зубов, каждый миллиметр ABL значимо ассоциировался с 5.23-кратное увеличение риска рака языка (OR, 5,23; 95% ДИ, 2,64–10,35). Другие оральные переменные (количество кариесов, пломб, коронок и лечения корневых каналов) не были существенно связаны с риском рака языка (Таблица 2).

Таблица 3 описывает средние значения ABL для случаев и контроля, стратифицированных по статусу курения. Связь между ABL и раком языка оставалась значительной независимо от статуса курения. Потеря альвеолярной кости была неизменно выше в случаях рака по сравнению с контрольной группой никогда (3.31 против 2,33 мм; P = 0,003), бывшие (4,12 против 2,58 мм; P <0,001) и нынешние (5,32 против 3,29 мм; P <0,001) курильщики.

Это исследование представляет, насколько нам известно, первое свидетельство возможной связи между хроническим периодонтитом и раком языка в анамнезе независимо от курения. Учитывая результаты предыдущих исследований, связывающих хронические инфекции и воспаление с риском рака в некоторых других органах, мы ожидали увидеть тенденцию в этом исследовании.Однако мы не ожидали увидеть такой четкой связи при относительно небольшом размере выборки. Таким образом, результаты этого предварительного исследования побуждают к более масштабным исследованиям с более полными оценками искажения, чтобы подтвердить эту связь.

Пародонтит — хроническое заболевание; он начинается и развивается очень медленно. Потеря альвеолярной кости, являющаяся результатом пародонтита, является необратимой и кумулятивной. Обнаруживаемый ABL на рентгенограммах отражает ранее существовавший хронический пародонтит, который обычно длился несколько десятилетий у пожилых людей, таких как наше.Это свидетельствует о временном том, что история пародонтита предшествовала диагностике рака. 16

Помимо хронического пародонтита, также оценивались эффекты зубных полостей, пломб, коронок и лечения корневых каналов, и результаты показывают, что пародонтит был единственной оральной переменной, которая была в значительной степени связана с раком полости рта. Однако небольшой размер выборки, а также тот факт, что диагнозы были поставлены на основе рентгенограмм, ограничивают нашу способность делать выводы.Диагностика кариеса недооценивается, и на рентгенограммах можно обнаружить только относительно запущенные поражения. 16 Будущие исследования с более чувствительными клиническими диагнозами дадут лучшие ответы.

Недостатком вторичного анализа данных является то, что он зависит от наличия данных с достаточной степенью детализации из ранее существовавших записей. В этом исследовании также была доступна ограниченная информация о переменных воздействия, которые могли затруднить связь между пародонтитом и раком полости рта.Например, не было данных об употреблении алкоголя, бездымного табака и диете. Кроме того, анамнез курения не был количественным, и не было доступной информации о времени с момента отказа от курения. Однако основная информация о возрасте, поле, расе, этнической принадлежности, статусе курения, гистологическом подтверждении диагноза рака, а также количественной и объективной оценке истории пародонтита с доказательствами временности позволила нам проверить нашу гипотезу. Кроме того, наблюдаемая ассоциация у никогда не куривших позволяет предположить, что эта ассоциация не зависит от курения.

Вопрос о том, как инфекция и воспаление могут влиять на канцерогенез, интересовал ученых на протяжении более полутора веков, но только сейчас возникают общие принципы и сложность этой связи. 4 -6 Хронические инфекции, такие как пародонтит, могут играть прямую или косвенную роль в канцерогенезе:

  1. Прямое токсическое действие микроорганизмов: Микроорганизмы и их продукты, такие как эндотоксины (липополисахариды), ферменты (протеазы, коллагеназы, фибринолизин и фосфолипаза A) и побочные продукты метаболизма (сероводород, аммиак и жирные кислоты) токсичны. к окружающим клеткам и может напрямую вызывать мутации в генах-супрессорах опухолей и протоонкогенах или изменять пути передачи сигналов, которые влияют на пролиферацию клеток и / или выживаемость эпителиальных клеток.

  2. Непрямое действие через воспаление: Хроническая инфекция может стимулировать образование эпителиальных опухолей через косвенный механизм, включающий активацию окружающих воспалительных клеток. Воспаление подвергает эпителиальные клетки воздействию веществ с мутагенным потенциалом. Микроорганизмы и их продукты активируют клетки-хозяева, такие как нейтрофилы, макрофаги, моноциты, лимфоциты, фибробласты и эпителиальные клетки, чтобы ( a ) генерировать активные формы кислорода (перекись водорода и оксирадикалы), активные формы азота (оксиды азота), реактивные липиды. и метаболиты (малоновый диальдегид и 4-гидрокси-2-ноненаль) и матриксные металлопротеиназы, которые могут вызывать повреждение ДНК в эпителиальных клетках и ( b ) продуцировать цитокины, хемокины, факторы роста и другие сигналы, которые обеспечивают среду для выживания клеток , пролиферация, миграция, ангиогенез и ингибирование апоптоза.Эта среда может помочь эпителиальным клеткам накапливать мутации и заставлять эти мутантные эпителиальные клетки размножаться, мигрировать и давать им преимущество в росте.

Таким образом, существенные данные предыдущих исследований подтверждают связь между хроническими инфекциями и повышенным риском рака. Следовательно, конкретная связь между хроническим пародонтитом и раком полости рта вероятна и требует изучения. Мы представили предварительные данные, предполагающие независимую связь между пародонтитом в анамнезе и риском рака языка.Эта связь должна быть подтверждена более крупными исследованиями, которые включают другие локализации рака полости рта, женщин и субъектов других рас с более полной оценкой искажения. Если эта связь подтверждена, это может иметь потенциальное влияние на понимание этиологии рака полости рта, а также на его профилактику и контроль.

Для корреспонденции: Mine Tezal, DDS, PhD, Elm and Carlton Street, Roswell Park Cancer Institute, Buffalo, NY 14263 (мой[email protected]).

Представлено для публикации: 2 августа 2006 г .; окончательная доработка получена 7 ноября 2006 г .; принята к печати 26 ноября 2006 г.

Вклад авторов: Доктор Тезал имел полный доступ ко всем данным в исследовании и берет на себя ответственность за целостность данных и точность анализа данных. Концепция и дизайн исследования : Тезал, Рид, Маршалл и Сканнапеко. Сбор данных : Тезал, Салливан, Лори, Лиллис и Хаук. Анализ и интерпретация данных : Тезал, Рид, Маршалл, Хайланд, Вактавски-Венде и Сканнапеко. Составление рукописи : Тезаль. Критический пересмотр рукописи для важного интеллектуального содержания : Рид, Маршалл, Хайланд, Лори, Вактавски-Венде и Сканнапеко. Статистический анализ : Тезал и Хайланд. Получено финансирование : Тезал, Салливан, Маршалл и Сканнапеко. Административная, техническая и материальная поддержка : Тезал, Салливан, Маршалл, Лори, Лиллис, Хаук и Сканнапеко. Научное руководство : Тезаль, Рид, Вактавски-Венде и Сканнапеко.

Раскрытие финансовой информации: Не сообщалось.

Финансирование / поддержка: Это исследование было поддержано грантом T32-DE07034 Национального института стоматологических и черепно-лицевых исследований и грантом 1R03CA119262-01A1 Национального института рака.

Предыдущая презентация: Это исследование было представлено на ежегодном собрании Американского общества головы и шеи в 2006 г. и на исследовательском семинаре по биологии, профилактике и лечению рака головы и шеи; 18 августа 2006 г .; Чикаго, штат Иллинойс.

Выражение признательности: Мы благодарим Дон Фрэнсис и других сотрудников отделения стоматологии и челюстно-лицевого протезирования онкологического института Розуэлл-Парк за их помощь в извлечении данных из медицинских карт пациентов.

3. канто МТДевса SS Показатели заболеваемости раком полости рта и глотки в США в 1975–1998 годах. Oral Oncol 2002; 38610-617PubMedGoogle ScholarCrossref 4. Карин MLawrence TNizet V Врожденный иммунитет пошатнулся: микробные инфекции связаны с хроническим воспалением и раком. Cell 2006; 124823-835PubMedGoogle ScholarCrossref 6. Совместная группа по хеликобактерам и раку, рак желудка и Helicobacter pylori. : комбинированный анализ 12 исследований случай-контроль, проведенных в рамках проспективных когорт. Кишечник 2001; 49347-353PubMedGoogle ScholarCrossref 7.Littman AJWhite EJackson Л.А. Хорнквист Инфекция MD Chlamydia pneumoniae и риск рака легких. Биомаркеры эпидемиологии рака Предыдущее 2004; 131624-1630 Google Scholar8.Экбом AHelmnick CZack M Язвенный колит и колоректальный рак, популяционное исследование. N Engl J Med 1990; 3231228-1233PubMedGoogle ScholarCrossref 9. Лазкано-Понсе ECMiquel JFMunoz N Эпидемиология и молекулярная патология рака желчного пузыря. CA Cancer J Clin 2001; 51349-364PubMedGoogle ScholarCrossref 11.Loesche WJGrossman Н.С. Заболевания пародонта как специфическая, хотя и хроническая инфекция: диагностика и лечение. Clin Microbiol Rev 2001; 14727-752PubMedGoogle ScholarCrossref 13.Hormia MWillberg JRuokonen H Маргинальный пародонт как потенциальный резервуар вируса папилломы человека в слизистой оболочке полости рта. J Periodontol 2005; 76358-363PubMedGoogle ScholarCrossref 14.Saygun И.Кубар АОЗДЕМИР Поражения пародонтита являются источником цитомегаловируса слюны и вируса Эпштейна-Барра. J Periodontal Res 2005; 40187-191PubMedGoogle ScholarCrossref 15.Хаусманн Эаллен К.Данфорд R Надежный компьютеризированный метод определения уровня рентгенографического альвеолярного гребня. J Периодонтальный анализ 1989; 24368-369PubMedGoogle ScholarCrossref

Что такое рак языка? — Clínica Blasi

07 янв. Что такое рак языка?

Опубликовано 14: 53h в Без категории Clinicablasiadm

Рак языка возникает в клетках языка. Это не единственный существующий рак ротовой полости, но есть и другие виды рака, поражающие ротовую полость.Очень важно знать, какой тип клеток ответственен за рак языка, так как это помогает установить наиболее подходящий прогноз и лечение. Этот рак обычно возникает из тонких гладких клеток, известных как плоскоклеточные клетки, которые полностью покрывают поверхность языка. В той части, где обнаружен рак языка, это также важный фактор, определяющий лечение.

Он может проявляться в двух местах:

В горле, на основе языка, этот тип рака имеет мало признаков и симптомов, поэтому его очень трудно обнаружить.Чаще всего он диагностируется на запущенной стадии и уже затронул лимфатические узлы на шее.

Во рту он находится там, где проявляется большим количеством признаков и симптомов, так как обнаруживается очень быстро и в большинстве случаев необходимо удалить только хирургическим путем.

Кроме того, следует иметь в виду, что рак, который проявляется у основания языка, очень часто связан с вирусом папилломы человека (ВПЧ), который является еще одним ключевым фактором для лечения и прогноза.

Какое лечение?

Обычно лечение включает в себя операцию по удалению опухоли. Вы должны принять во внимание фазу, в которой вы находитесь, поскольку иногда есть альтернативы:

  • Целевая лекарственная терапия
  • Химиотерапия
  • Лучевая терапия

Мы хотим, чтобы вы знали, что эти методы лечения могут быть уже запущенная стадия рака влияет на вашу способность есть и говорить. Но есть реабилитационные бригады, призванные помочь справиться с этими изменениями.

Мы в Clínica Blasi хотим, чтобы вы были в курсе, что самое важное — это здоровье полости рта наших пациентов.

(PDF) Анатомия языка и рак полости рта: Путь метастазирования

Мария Пьягкоу, Теано Деместича, Димитриос Лаппас и др.

ССЫЛКИ

Clark R, Shoaib T, Soutar D, Gray H, Bessent R, McCurrach G, MacKie R,

MacLeod T, MacDonald D, Camilleri I. Биопсия сторожевого лимфатического узла при

— возможная злокачественная меланома полости рта средства клинического исследования шеи

без лимфатических узлов.Евро. J. Plast. Surg. 2006; 28: 403–407.

Доннелли Л.Ф., Джонс Б.В., Страйф Дж.Л. Визуализация детского языка

Аномалии. AJR 2000; 175: 489–493.

Ehsan-ul-Haq M, Warraich RA, Abid H, Sajid MA. Шейный лимфатический узел

метастазы в плоскоклеточный рак языка и дна рта. J.

Coll. Врачи Surg. Пак. 2011 Янв; 21: 55-56.

Godden D, Ribeiro N, Hassanein K, Langton SG. Рецидивирующая болезнь шеи в

Рак полости рта.J. Oral Maxillofac. Surg. 2002; 60: 748-753.

Haddadin KJ, Soutar DS, Oliver RJ, Webster MH, Robertson AG, MacDonald

DG. Повышение выживаемости для пациентов с клиническими опухолями T1 / T2, N0 языка

, перенесших профилактическое рассечение шеи. Head Neck 1999;

21: 517–525.

Хан XG, Li JR, Pi X. Исследование распределения и дренажа лимфатических сосудов

языка. Хуа Си Коу Цян И Сюэ За Чжи 2005; 23: 400-403.

Кавагути Т.Метастаз рака: теория и ее клиническое применение,

Канехара, Токио, 1994 (на японском языке).

Кавагути Т. Фундаментальные аспекты метастазирования рака; Канехара: Токио,

2002 (на японском языке).

Кавадзу Т., Казуюки А., Йошиура К., Накаяма Е., Канда С. Применение нейронных сетей

для прогнозирования метастазов лимфатических узлов в полости рта

Рак. Oral Radiol. 2003; 19: 137-142.

Кишимото К., Сасаки А., Ёсихама Y, Месе Х., Цукамото Г., Мацумура Т.

Экспрессия фактора роста сосудистого эндотелия-C предсказывает регионарные метастазы

лимфатических узлов при ранней плоскоклеточной карциноме полости рта. Оральный

Онкол. 39: 391-396, 2003.

Maher WP. Артериальные, венозные и лимфатические пути слизистой оболочки спины собаки

язык (предполагаемые пути метастатических поражений). Microcirc. Эндотелий.

Lymphatics 1985; 2: 161-184.

Nithya CS, Pandey M, Naik BR, Ahamed I.Паттерны метастазов в шейку матки

от рака ротовой полости. Всемирный журнал хирургической онкологии

2003, 1:10.

14

Транскриптомный анализ рака языка на основе высокопроизводительного секвенирования

Введение

Рак полости рта — это распространенная злокачественная опухоль. Должен частая механическая стимуляция, частое попадание языка плоскоклеточный рак занимает первое место среди случаев рака полости рта, и заболеваемость продолжает расти (1,2).В заболеваемость раком языка явно выше среди пожилых пациенты, так как большинство пациентов в возрасте ~ 60 лет (3). Рак полости рта характеризуется как сильно злокачественные, с высокой частотой местных рецидивов и метастазы в шейных лимфатических узлах (4,5). В настоящее время операция сочетается с послеоперационной лучевой терапией и химиотерапия является предпочтительным методом лечения рака языка (6). Из-за кратковременного рецидива и низкая терапевтическая эффективность, рак ротовой полости имеет мрачный прогноз и серьезно влияет на качество жизни пострадавших пациентов (7).5-летняя выживаемость Сообщается, что рак ротовой полости составляет ~ 50% (8). Симптомы рака полости рта на ранней стадии нетипичны, и их часто принимают за укус или легкий колющая боль. Следовательно, несколько пациентов с раком полости рта у вас уже есть заболевание средней или поздней стадии на начальной стадии диагноз и, таким образом, пропустили оптимальное окно для лечения. Рак языка необходимо прогнозировать и диагностировать как можно раньше; Таким образом, очень важно выяснить молекулярные механизмы лежащие в основе его этиологии и патогенеза.

Биоинформатический анализ профилей экспрессии генов активно выполняются в последние годы. Как сборка РНК транскриптом в основном транскрибируется со специфических ткани или клетки в определенной фазе или функциональном состоянии. Анализируя данные транскриптома позволяют оценить общую функцию гена и структура, тем самым выясняя потенциальные молекулярные механизмы лежащие в основе патологические состояния и ранее применялись широко используется в исследованиях рака (9). Некодирующие РНК (нкРНК) представляют собой тип РНК, транскрибируемой из ДНК. которому не хватает способности кодировать белок.Критические функции нкРНК были выявлены почти во всех аспектах прогрессирования рака (10,11).

Анализы транскриптомов были хорошо задокументированы в исследования рака; однако было проведено мало анализов транскриптомов. сообщалось о раке языка и традиционном in vivo в настоящее время предпочтительны эксперименты или исследования одного гена. К насколько нам известно, это первое на сегодняшний день исследование, исследовать дифференциально экспрессируемые мРНК и нкРНК на языке рака и околораковых тканей с помощью анализа транскриптома, в надеюсь, что результаты могут помочь определить потенциальные цели для диагностика и клиническое лечение рака языка на ранней стадии.

Материалы и методы
Субъектов

Настоящее исследование одобрено Службой медицинской этики. Комитет муниципальной онкологической больницы Наньтун (разрешение № 2018037). Ткани рака языка и соответствующие парараковые ткани (расположенные на расстоянии ~ 3 см от раковых тканей) хирургическим путем взяты у 4 пациентов с раком языка (случаи 1–4, Таблица I). Всего было 3 мужчины и 1 женщина. зарегистрированы, средний возраст 67 лет. Патологически 3 из пациенты имели хорошо дифференцированный плоскоклеточный рак (n = 2 с T3N2bM0, стадия IVb и n = 1 с T2N2cM0, стадия IVb), и 1 пациент имел умеренно дифференцированный плоскоклеточный рак (T2N0M0, II этап).Исходя из подтипов рака языка, у 3 пациентов язвенный инфильтрирующий рак языка, и у 1 был экзофитный язык рак. Образцы, использованные для количественной ПЦР с обратной транскрипцией (RT-qPCR) были извлечены у 20 пациентов, данные которых представлены в Дополнительная таблица SI. Значение возраст этих пациентов составлял 61,6 года (от 51 до 73 лет).

Таблица I.

Основная информация для пациента.

Таблица I.

Основная информация для пациента.

№ корпуса Возраст, лет Пол Стадия Дифференциация Тип
1 66 Мужской T3N2bM0, IVb Хорошо дифференцированный Язвенный инфильтрация
2 73 Мужской T2N0M0, II Хорошо дифференцированный Экзогенный
3 57 Мужской T3N2bM0, IVb Умеренно дифференцированный Язвенный инфильтрация
4 73 Женский T2N2cM0, IVb Хорошо дифференцированный Язвенный проникновение
Гематоксилин и эозин (H&E) окрашивание

Использовали рак языка и околопухолевые ткани. для морфологического наблюдения с окрашиванием H&E, как и ранее описано (12).Все последующие шаги выполняются при комнатной температуре. Вкратце, ткани были фиксируется в параформальдегиде в течение 4 ч, обезвоживается в концентрации этанола (от 70 до 100%, 1 мин каждая), проницаемость в ксилоле на 5 мин и залили парафином. После встраивания ткани разрезали на срезы 4 мкм, промывали в нисходящем концентрации этанола для удаления ксилола (от 100 до 75%, 1 мин. каждый, с заключительной стиркой в ​​воде), окрашенные гематоксилином в течение 5 мин с последующим промыванием в воде, а затем окрашиванием эозином в течение 2 мин.Срезы наблюдались, и изображения были захвачены в увеличение × 100 с использованием инвертированного микроскопа Olympus IX71 (Корпорация Olympus).

Конструирование библиотеки кДНК
и секвенирование

Общая РНК была извлечена из рака языка и парараковые ткани с использованием реагента TRIzol (Thermo Fisher Scientific, Inc.). Определяли концентрацию и чистоту РНК. с помощью ультрафиолетового спектрофотометра (RAY-757CRT; Raylabel Инструментальная компания, ООО). Библиотека кДНК была сконструирована и секвенировали, как описано ранее (13).Короче говоря, как можно больше рРНК удаляли для получения очищенной РНК. Впоследствии мРНК и нкРНК разделяли поли (А) сплайсингом. РНК была случайным образом нарезанные на короткие фрагменты, которые использовались в качестве шаблонов. В кДНК первой цепи синтезировали вместе со случайными праймерами длиной 6 пар оснований. КДНК второй цепи синтезировали с использованием коммерческого набора. (Takara Biotechnology Co., Ltd.), следуя указаниям производителя инструкции. После очистки, конечного ремонта, А-хвоста и После добавления адапторных последовательностей кДНК фрагментировали с использованием урацилгликозилаза.

фрагментов кДНК подвергали ПЦР-амплификации, и была сконструирована комплементарная библиотека кДНК. нкРНК и мРНК секвенировали с использованием высокопроизводительного и высокочувствительного Платформа для секвенирования HiSeq 2500 (Illumina, Inc.). Последовательные данные были проанализированы и обработаны для динамического удаления последовательности фрагменты на 3′-конце и фрагменты низкого качества с использованием Trim Galore −0.6.5 (Институт Бабрахама). Наконец, версия Fast-QC 0.11.8 (Институт Бабрахама) использовалась для оценки качества предварительно обработанные данные.

Сравнение со ссылкой последовательности
Данные

RNA-Seq сравнивали с эталонными данными. база данных (GRCh, версия 38) с использованием программного обеспечения Hisat2 версии 2.1.0 (Университет Джона Хопкинса). Данные были сопоставлены с индексом 56 КБ генетическое картирование судьбы. Показания были быстро и точно локализованы на геном для получения геномной структуры секвенирования данные.

Анализ дифференциально экспрессируемых гены

Экспрессия гена была определена количественно путем считывания на килобаз на миллион отображенных чтений (RPKM), которое было рассчитано с использованием программного обеспечения Htseq версии 0.9.0 (GitHuB, Фабио Занини, Университет Нового Южного Уэльса, Сидней) следующим образом: RPKM = total чтения экзона / [отображенные чтения × длина экзона (kb)]. Сложить изменения (FC) дифференциально экспрессируемые гены рака языка и рассчитывались околопуховые ткани. Гены с log2 FC> 1 или <-1 и коэффициент ложного обнаружения ≤0,05 были выбрано.

Анализ онтологии генов (GO)
Анализ

GO выявил значительное обогащение термины, связанные с биологическими процессами, молекулярными функциями и клеточные компоненты.Условия GO были назначены на дифференцированной основе. экспрессировали мРНК и гены хозяина со значительно различающимися circRNA. P-значение каждого члена GO рассчитывалось с использованием Фишера. точный тест, а P <0,05 считалось статистически значительные различия.

Киотская энциклопедия генов и Анализ геномов (KEGG)
,00

Аннотации пути дифференциально экспрессируемых генов было выполнено с использованием базы данных KEGG. P-значение каждого пути участвующих был проанализирован с использованием точного теста Фишера на основе гипергеометрическое распределение.Считалось, что P <0,05 указывает на статистически значимые различия.

RT-qPCR

Рак языка и околопухолевые ткани каждого пациент рассматривался как группа образцов для проверки изменений генов, связанных с раком, методом RT-qPCR. Общий размер выборки составил 20 человек. и основная информация о пациенте представлена ​​в Таблице SI.

По результатам экспрессии генов и анализ сигнального пути, 10 генов, которые были значительно разные и были связаны с раком. ОТ-КПЦР.Их праймеры перечислены в таблице II (Sangon Biotech, Co., Ltd.). В В качестве набора для обратной транскрипции использовался набор реагентов PrimeScript ™ RT с gDNA Eraser (Takara Biotechnology Co., Ltd.), сначала при 42 ° C в течение 2 мин с ластиком гДНК и буфером 1, а затем при 37 ° C в течение 15 мин и 85 ° C в течение 5 секунд со смесью ферментов, RT-праймером и буфером 2. КПЦР (Takara Biotechnology Co., Ltd.) проводили при 95 ° C в течение 10 мин, затем при 95 ° C в течение 15 секунд, 60 ° C в течение 30 секунд и 72 ° C в течение 40 секунд в течение 40 секунд. циклов, с заключительным этапом при 72 ° C в течение 5 мин.Были установлены реакции в 96-луночных планшетах Microseal PCR (Bio-Rad Laboratories, Inc.) в трех экземплярах.

Таблица II.

Праймеры в обратном направлении транскрипционно-количественная ПЦР.

Таблица II.

Праймеры в обратном направлении транскрипционно-количественная ПЦР.

Gene Праймеры (5′-3 ‘)
COL4A6 F: CTAACTATCTAAGGGGCTGTGC
R: ATTGGCTGATGGTGAGATTTGTATC
SPP1 F: AGAAGTTTCGCAGACCTGAC
R: TTTCAGCACTCTGGTCATCC
FN1 F: TACCATCAGAGAACAAACACTAATG
R: AAGAACTCTAAGCTGGGTCTGC
MMP13 F: TCTGGACAGACTGGCTGTTG
R: TTGAAGGGATGTGATGGTCA
CXCL13 F: CTCTGCTTCTCATGCTGCTG
R: CAGCTTGAGGGTCCACACAC
MMP9 F: TTCAGGAGACGCCCATTTC
R: GTCGTCGGTGTCGTAGTTGG
COL10A1 F: CATGCCTGATGGCTTCATAAA
R: AAGCAGACACGGGCATACCT
COL27a1 F: GGAACGGACAGGTCTTTGAA
R: GGGTCCGGAAGGTGAATAGT
COL4A1 F: GAACGGGCCCATGGACAGGACTTG
R: AGGTGGACGGCGTAGGCTTCTTG
CXCL10 F: GTACGCTGTACCTGCATCAGCATTAG
R: CTGGATTCAGACATCTCTTCTCACCC
Сеть передачи сигналов

Сети путей передачи сигналов были изображены с использованием Cytoscape 3.4.0 (Институт системной биологии). Каждый сеть путей была изображена на основе условий пути, и те с P <0,05 были проанализированы KEGG.

Статистический анализ

Данные представлены как среднее значение ± стандартная ошибка значение. Данные РНК-секвенирования были получены из 4 независимых экспериментов, в то время как данные RT-qPCR были получены из 20. Эти данные в основном сравнивались с помощью log2FC, чтобы объяснить усиление экспрессии генов в раковых тканях.

Результаты
Характеристики ткани и морфология

Репрезентативные патологические изображения показаны на Инжир.1. Нормальная слизистая оболочка языка состоит из многослойного плоского эпителия, а рак языка ткани в большинстве своем были высокодифференцированными, сопровождались большими количество внеклеточного ороговения и межклеточного мосты.

Массовый анализ данных RNA-Seq

Секвенирование транскриптомов и фильтрация данных были проведено на 4-х парных парах рака языка и паракологических ткани. После удаления последовательностей адаптеров полученные данные были по сравнению с эталонным геномом.Большие последовательности данных и высокий уникальные скорости отображения образцов показали, что количество и качество секвенированных данных соответствовало требования. Необработанные данные были загружены в NCBI онлайн. база данных, а инвентарный номер — GSE143950.

Состав генома секвенированного образцы

Анализ главных компонентов (рис. 2A) показал хороший эффект кластеризации. как для раковых, так и для прилегающих тканей. Генетический состав образцов в экзонах, интронах и межгенных области показана на рис.2Б. Обильные РНК-транскрипты были обнаружены как в экзонах, так и в интронах, предполагая наличие многочисленных нкРНК. Генный состав и распределение по хромосомам показано на фиг. 2C. По сравнению с паракологическим раком тканях, Chr.14 был активирован, в то время как Chr.MT был подавлен в ткани рака языка. Экспрессия гена у каждого пациента раковые и парараковые ткани показаны на рис. 2D.

Анализы дифференциально выраженных гены

Экспрессия генов была определена количественно с помощью RPKM.Уровни экспрессии были рассчитаны и изображены в виде вулкана. сюжеты. Всего было исследовано 24 582 гена, из них 1700 повышенная регуляция и 2249 пониженная регуляция (рис. 3). ТОП-20 дифференциально экспрессированные мРНК и нкРНК перечислены в таблице III. Четыре лучших гена были MMP13. (log2FC = 11,35), KRTAP13-2 (log2FC = -10,52), KRT36 (log2FC = -10,07) и S100A7A (log2FC = 10.00). Тепловая карта показала, что тенденция изменение экспрессии генов было постоянным у всех 4 пациентов, а различия между злокачественной и парахарактерной тканями были статистически значимый.

Таблица III.

Топ-10 дифференциально экспрессируемых генов среди мРНК и некодирующих (нк) РНК.

Таблица III.

Топ-10 дифференциально экспрессируемых генов среди мРНК и некодирующих (нк) РНК.

632 8,96 903 00 47
A, мРНК

Идентификатор гена журнал 2 FC Регулировка вверх / вниз
KRTAP13-2 −10.52 Пух
KRT36 −10,07 Пух
KRTAP13-1 −9,95 Пух
Вниз
CA9 9,07 Вверх
IL24 9,27 Вверх
MMP10 9,8325 вверх
MMP13 11,35 вверх

B, нкРНК

Идентификатор гена журнал 2 FC Регулировка вверх / вниз

RMST −8,62 Вниз
LOC105375180 −7.20 Вниз
DIO2-AS1 −6,83 Вниз
LOC105372641 −6,82 Вниз −6,82 Вниз

TATDN2
TATDN2 9095 Вверх
LOC101928272 7,26 Вверх
AFAP1-AS1 7,33 Вверх
RFTN1P1 7 вверх
LINC01322 8,86 вверх
Анализ GO

Гены, которые дифференциально экспрессировались в были проанализированы рак языка и парараковые ткани. GO анализ обнаружил существенно обогащенные термины, связанные с тремя предметами: i) Биологические процессы: организация внеклеточного матрикса (ЕСМ), клеточная адгезия, катаболические процессы коллагена, разборка ECM и интегрин-опосредованный сигнальный путь; ii) молекулярные функции: Связывание ионов кальция, связывание интегрина, активность фактора роста и Структурные элементы ECM; и iii) клеточные компоненты: Белковый ВКМ, внеклеточная область и ВКМ.Большинство значительно обогащенные термины были проанализированы как организация ECM и клеточная адгезия (рис. 4 и 5).

Анализ KEGG

путей, идентифицированных с помощью пути KEGG аннотации и анализа, 61 был значительно подавлен, а 43 были активированы (рис. 6). Большинство дифференциально активированными путями были очаговая адгезия, ECM-рецептор взаимодействие, пути при раке, мелкоклеточный рак легкого, фосфоинозитид-3-киназа (PI3K) -Akt передача сигналов и клеточная адгезия молекулы (САМ).

RT-qPCR

Сравнивались разности кратных изменений. между RNA-seq и RT-qPCR. Результаты показаны на фиг. 7. Все эти 10 генов были активированы. в раковых тканях, и не было значительных биологических разница между RT-qPCR и RNA-seq, указывающая на то, что RNA-seq результаты соответствовали результатам RT-qPCR.

Сеть передачи сигналов

Возможные взаимодействия между дифференциально выраженные пути были изображены в сети путей, в том числе передача сигналов митоген-активируемой протеинкиназы, передача сигналов PI3K-Akt, рак, кальциевые сигнальные пути и пути очаговой адгезии (рис.8).

Обсуждение

Рак языка — распространенное злокачественное заболевание, которое трудно диагностировать на ранних стадиях и характеризуется высокой частотой метастазов и послеоперационных рецидивов (4). Следовательно, молекулярные механизмы причастен к раку языка, необходимо выяснить, чтобы улучшить клинические исходы больных. В сложном патологическая сеть онкогенеза, аномальная активация или подавление одного гена не может адекватно проиллюстрировать сложные изменения транскриптома в процессе развития опухоли.Следовательно, аннотации путей GO и KEGG использовались в настоящее исследование для анализа данных транскриптома языка рак.

Анализ

GO выявил существенно обогащенные термины связанные с организацией ECM (активная регуляция), клеточная адгезия (подавление) и катаболические процессы коллагена (усиление). Анализ KEGG показал, что эти дифференциально экспрессируемые гены были в основном обогащены путем фокальной адгезии (повышенная регуляция), путь взаимодействия ЕСМ-рецептора (повышенная регуляция), Путь PI3K-Akt (с активизацией) и CAM (с подавлением).ОТ-КПЦР был использован для проверки результатов секвенирования.

Возникновение, прогрессирование и метастазирование языка рак тесно связаны с ВКМ (14). Разрастание и фиброз сообщалось, что соединительные ткани сопровождают онкогенез и прогрессирование солидных опухолей (15,16). Повышенная регуляция коллагена I типа, фибронектина (FN1) и других ECM белки при раке груди (17,18) и повышенная регуляция коллагенов, неколлагеновых гликопротеинов и протеогликаны при гепатоцеллюлярной карциноме (19) предполагают, что экспрессия и изменения компонентов в ECM являются решающими индикаторами опухоли прогрессия.Наши результаты РНК-Seq показали снижение эластина сборка и повышенная деградация коллагена при раке языка ткани. Текущие данные показали, что фиброзная ткань гиперплазия — это защитная реакция организма, которую можно использовать как прогностический индикатор (20). Аномальное отложение и повышенная жесткость ECM очевидны в фиброзные и злокачественные раковые ткани (21). Неоваскуляризация — отличительный признак рак. Семейство генов коллагена (COL) кодирует коллаген в ECM, которые могут участвовать в индукции ангиогенеза при раке (22-24).Результаты секвенирования и кПЦР показали, что COL4A1 и COL4A6 были значительно активированы при раке языка, что позволяет предположить, что эти гены могут играть важную роль в возникновении и развитие рака языка. Матричные металлопротеиназы (ММП) представляют собой важные ферменты в ECM, которые могут разрушить подвал мембрана и ECM и способствуют инвазии и метастазированию опухолевых клеток (25–27). ММП-9 и ММП-13 оказались значительно усиливается при раке языка, что еще раз подтвердило это функция.

ЕСМ млекопитающих состоит из ~ 300 белков. (28).ECM действует как структурный поддержка и медиатор инфильтрации для тканей и органов, а также в качестве медиатор клеточного сигнала, который регулирует фенотипы клеток с помощью передача сигналов через рецепторы мембранной поверхности. Соответствующий исследование гепатоцеллюлярной карциномы показало, что простагландин E2 (PGE2) активирует рецептор простагландина EP3 (PTGER3) в мезенхимальные клетки, окружающие опухолевые клетки, тем самым способствуя активация и высвобождение фактора роста эндотелия сосудов, MMP-2 и ММП-9; таким образом, PGE2 в конечном итоге способствует ангиогенезу и рост опухолевых клеток (29).В Кроме того, было обнаружено, что PTGER3 регулирует рост клеток рака простаты. воздействуя на рецепторы андрогенов (30). Анализ KEGG показал, что несколько Взаимодействия ЕСМ-рецептора были значительно усилены и обогащенный. Как изображено в сети KEGG, ECM-рецептор путь взаимодействия был напрямую связан с путями при раке, а именно путь мелкоклеточного рака легкого, путь PI3K-Akt и САМ в тканях рака языка. Взаимодействие между ECM и считается, что рецепторы клеточных мембран играют ключевую роль в языке развитие рака, предполагая, что блокирование такого взаимодействия может подавить развитие рака языка и метастазирование.Хемокины являются цитокинами, которые мобилизуют клетки посредством хемотаксиса. Это было раньше продемонстрировали, что CXCL10, CXCL13 и другие хемокины близко связаны с возникновением и развитием рака (31,32). Результаты секвенирования и ПЦР в настоящем исследовании подтвердили, что уровни экспрессии CXCL10, CXCL13 и других хемокинов в ткани рака языка были значительно увеличены, что позволяет предположить их значение при раке языка.

Путь PI3K-Akt широко распространен в различные клетки и, как известно, регулируют клеточное поведение, белок синтез и ангиогенез (33).При патологических условиях нарушение регуляции PI3K-Akt Этот путь может спровоцировать возникновение и прогрессирование рака (34). Считается, что три механизма отвечает за биологические функции пути PI3K-Akt в рак. Во-первых, путь PI3K-Akt подавляет апоптоз и стимулирует пролиферацию клеток. p-Akt может подавлять митохондриальную апоптотический путь путем подавления каспазы-9 (35). p-Akt также может ингибировать апоптоз клеток. и способствуют пролиферации за счет активации киназы гликогенсинтазы 3β, белки FOX, протоонкоген MDM2 и транскрипция фактор NF-κB (36).Во-вторых, Путь PI3K-Akt регулирует развитие клеточного цикла. Передавая митотический сигнал к p70s6k, путь PI3K-Akt активирует экспрессия белков, связанных с клеточным циклом, и CDK4. Впоследствии повышенная регуляция CDK4 ингибирует понижающую регуляцию p21Cip1 / WAF1 и p27Kip1, тем самым запуская переход от G1 к S-фаза (37). Наконец, Путь PI3K-Akt стимулирует ангиогенез опухоли и опухолевые клетки миграция за счет активации факторов, индуцируемых гипоксией, азотной оксид и циклооксигеназа 2.После активации пути PI3K-Akt, подавленный E-кадгерин, который регулируется фосфорилированным гликогенсинтаза, инактивирует молекулы межклеточной адгезии и усиливает метастатическую способность опухолевых клеток (38).

САМ — это функциональные молекулы, которые опосредуют контакт и связывание между клетками или между клетками и ECM. САМ проявляют свои биологические эффекты через связывание рецептор-лиганд, и участвовать в физиологических и патологических процессах, включая пролиферацию, дифференциацию, движение клеток, иммунную и воспалительные реакции, коагуляция и метастазирование раковых клеток.Обычно САМ включают семейство интегринов, иммуноглобулин надсемейством, семейством селектинов, семейством кадгеринов и др. молекулы адгезии. Эпителиально-мезенхимальный переход (ЭМП) обычно возникает во время прогрессирования опухоли и эмбрионального развития, приводящая к трансформации клеток эпителиального фенотипа с сильной адгезией к мезенхимальному фенотипу с инвазивным способность и повышенная моторика (39). EMT вызывает ослабление межклеточного соединений в изотипах на основе кадгерина и ослабляет способность клеток, чтобы закрепиться в цитоскелете через кадгерин-катенин.Впоследствии активированные САМ со слабой адгезией или гетеротипные САМ вызвать отделение опухолевых клеток in situ и проникновение в кровообращение или лимфатическая циркуляция. САМ регулируют межклеточную адгезию и взаимодействия между клетками и окружающей средой микросреда. Более того, САМ и их соответствующие пути играют важные роли на разных стадиях прогрессирования опухоли (40).

Фокальные спайки (FA) являются основными медиаторами соединение между ячейками и ECM. ЖК вызывают усиление опухоли подвижность клеток и EMT посредством передачи сигналов на основе интегрина и механическая структурная опора.Активная регуляция генов в FA этот путь тесно связан с прогрессированием рака языка. Во время злокачественного прогрессирования атипичной дисплазии ротовой полости. эпителий слизистой оболочки в плоскоклеточный рак полости рта, очаговый киназа адгезии (FAK) постепенно повышается. Таким образом, ФАК может быть используется в качестве диагностического маркера предракового эпителия полости рта. поражения (41). В ФАК — / — у мышей скорость образования папиллом снизилась на 50%; когда-то добрый образовались опухоли, потеря FAK тормозила злокачественное прогрессирование (42).Блокирование пути FAK было показано, что заметно снижает способность к адгезии клеток и клеточную инвазию и подвижность при плоскоклеточном раке головы и шеи (43). FAK активируется в большинстве опухолей, и его уровень связан со злокачественным поведением опухоли. Уровни FAK заметно выше при злокачественных метастазах. опухолевые ткани по сравнению с нормальными тканями или инвазивными опухолевые ткани (44). Соответствующий клиническое исследование показало, что уровни экспрессии FAK обратно пропорциональны коррелировал с выживаемостью пациентов с опухолями (45).Следовательно, FAK может быть потенциальным диагностический маркер рака языка на ранней стадии и рецепторы FAK могут представлять собой многообещающие терапевтические цели. В данном исследовании, Было обнаружено, что FN1 высоко экспрессируется в тканях рака языка. В кроме того, секретируемый фосфопротеин 1 (SPP1; также называемый остеопонтин), представляет собой секретируемый фосфорилированный гликопротеин, участвующий в клеточная адгезия, пролиферация, миграция, воспаление, иммунная ответ и передача сигнала, и могут вызывать новый ангиогенез (46,47).Настоящее исследование показало, что SPP1 значительно повышается при раке языка, что позволяет предположить, что что FN1 и SPP1 играют важную роль в развитии языка рак.

В совокупности активность FAK, ECM-рецептора, Пути PI3K-Akt и CAM сильно различаются при раке языка возникновение и прогрессирование. Активированный путь PI3K-Akt стимулирует пролиферацию клеток, изменяет клеточный цикл, подавляет апоптоз и индуцирует ангиогенез. Фосфорилированный гликоген синтазы дополнительно подавляют E-кадгерин и, таким образом, блокируют CAM путь.Нарушение CAM приводит к изменениям состава в сигнальные молекулы в ECM, которые, в свою очередь, вызывают изменения в соответствующих направлениях. Кроме того, уникальная микросреда затронуты изменениями компонентов и жесткости блока управления двигателем. влияют на метастазирование опухолевых клеток. Таким образом, прогрессия, вторжение а метастазирование злокачественных опухолей — динамический процесс. В было показано, что взаимодействие между сигналом PI3K-Akt и САМ запускают изменения в ECM, тем самым усугубляя неблагоприятный микросреда при раке языка.

В настоящем исследовании потенциальные молекулярные механизмы и связанные с опухолью пути во время прогрессирования рака языка были проанализированы с помощью RNA-Seq. Однако должны быть определенные ограничения. адресованный. Во-первых, небольшой размер выборки мог привести к тому, что отдельные предвзятость. Поскольку секвенирование транскриптома — это чувствительное обнаружение метода, наши данные о последовательности предоставили только справочную информацию. Во-вторых, дифференциально экспрессируемые пути были многочисленны, а некоторые были значительными во время прогрессирования рака языка.Критический пути и механизмы, лежащие в основе рака языка, требуют дальнейшего изучение.

В заключение расшифровка стенограмм с четырех языков раковые ткани и четыре парные парараковые ткани были проанализированы, и 1700 усиленных и 2249 пониженных генов были идентифицированы. Эти дифференциально экспрессируемые гены были в основном обогащен FA, взаимодействием ECM-рецептора, PI3K-Akt и CAM пути. Эти пути синергетически способствовали развитию рака языка. возникновение и прогрессирование, а также могут быть потенциальными биологическими маркерами и терапевтические цели для рака языка на ранней стадии.Однако из-за к небольшому размеру выборки и чувствительности RNA-Seq, в дальнейшем исследования молекулярной биологии необходимы для выяснения роли дифференциально выраженные пути прогрессирования рака языка, в чтобы обеспечить более широкую теоретическую и экспериментальную основу для клиническая диагностика, лечение и прогноз пациентов с языком рак.

Дополнительные материалы
Вспомогательные данные
Благодарности

Не применимо.

Финансирование

Настоящее исследование поддержано Nantong Science. и технологические проекты (гранты №MS22018011, GJZ17103, MS12018059 и MS32017004).

Наличие материалов и данных

Все данные, созданные или проанализированные в настоящее время исследования включены в эту опубликованную статью.

Авторские взносы

MMT и LH разработали исследование и составили проект рукопись. MMT, HW, WCD, XJX и BJ проводили эксперименты, и способствовал сбору и анализу данных. YZW, HYQ и LH внес вклад в анализ данных и проанализировал его. Все авторы имеют прочитал и утвердил окончательный вариант рукописи.

Утверждение этических норм и согласие на участвовать

Настоящее исследование одобрено Службой медицинской этики. Комитет городской онкологической больницы Наньтун (№ 2018037).

Согласие пациента на публикацию

Не применимо.

Конкурирующие интересы

Все авторы заявляют, что у них нет конкурирующих интересы.

Список литературы

1

Уэйд Дж., Смит Х., Хэнкинс М и Ллевеллин C: Проведение стоматологических осмотров на рак в общей практике: Какие препятствия? Fam Pract.27: 77–84. 2010. Просмотр статьи: Google Scholar

2

Немет З., Сомоги А., Такачи-Надь З., Барабас Дж., Немет Дж. И Сабо Дж.: Возможности предотвращения остеорадионекроза при комплексной терапии опухолей полости рта полость. Pathol Oncol Res. 6: 53–58. 2000. Просмотр статьи: Google Scholar

3

Манн Дж., Джули Д., Махас СС, Д’Анджело Д., Potters L, Wernicke AG и Parashar B: Выборочное рассечение шеи, но не адъювантная лучевая терапия, улучшает выживаемость на стадии I и II рак языка полости рта с глубиной инвазии> 4 мм.Cureus. 11: e62882019.

4

Варнакуласурия С: Глобальная эпидемиология рак полости рта и ротоглотки. Oral Oncol. 45: 309–316. 2009 г. Просмотр статьи: Google Scholar

5

Хао С.П. и Цанг Н.М.: роль надподъязычная диссекция шеи у больных раком полости рта. Oral Οncol. 38: 309–312. 2002. Просмотр статьи: Google Scholar

6

St John MA, Abemayor E и Wong DT: Недавние новые подходы к лечению рака головы и шеи.Противораковые препараты. 17: 365–375. 2006. Просмотр статьи: Google Scholar

7

Калабрезе L, Брускини R, Джульяно G, Остуни А, Маффини Ф, Массаро М.А., Санторо Л, Навач В, Преда Л, Alterio D и др.: Хирургия отсеков языка: долгосрочные онкологические заболевания. приводит к лечению рака языка. Oral Oncol. 47: 174–179. 2011. Просмотр статьи: Google Scholar

8

Ума Р.С., Нареш К.Н., Д’Круз А.К., Мулхеркар Р. и Борхес AM: Метастаз плоскоклеточного рака полости рта. язык связан с подавлением эпидермальных жирных кислот связывающий белок (E-FABP).Oral Oncol. 43: 27–32. 2007. Просмотр статьи: Google Scholar

9

Сунь QL, Чжао С.П., Ван Т.Ю., Хао ХБ, Ван XY, Чжан X и Ли YC: анализ профиля экспрессии длительного некодирования РНК, связанная с устойчивостью к винкристину в раковых клетках толстой кишки путем секвенирование нового поколения. Ген. 572: 79–86. 2015. Просмотр статьи: Google Scholar

10

Иорио М.В. и Кроче С.М.: причины и последствия нарушения регуляции микроРНК.Рак J. 18: 215–222. 2012 г. Просмотр статьи: Google Scholar:

11

Ван Ф, Рен Х и Чжан Икс: роль микроРНК-150 в солидных опухолях. Oncol Lett. 10: 11–16. 2015 г. Просмотр статьи: Google Scholar:

12

Чжан Х.Л., Ю ЛХ, Ян В., Тан Л, Линь И, Ву. H, Zhai B, Tan YX, Shan L, Liu Q и др.: Глубокое воздействие на кишечник гомеостаз при химически индуцированном проколкогенном воспалении и гепатоканцерогенез у крыс.J Hepatol. 57: 803–812. 2012 г. Просмотр статьи: Google Scholar

13

Айер М.К., Никнафс Ю.С., Малик Р., Сингхал У., Саху А., Хосоно Ю., Барретт Т.Р., Пренснер Дж. Р., Эванс Дж. Р., Чжао С. и др. al: Пейзаж длинных некодирующих РНК у человека транскриптом. Нат Жене. 47: 199–208. 2015. Просмотр статьи: Google Scholar:

14

Раклидж Г.Дж., Дин В., Робинс С.П., Мелла О. и Бьерквиг Р.: Иммунолокализация белков внеклеточного матрикса. при инвазии опухоли головного мозга у крыс BD IX.Cancer Res. 49: 5419–5423. 1989.

15

Олунд Д., Эльяда Э. и Тувсон Д.: Неоднородность фибробластов раковой раны. J Exp Med. 211: 1503–1523. 2014. Просмотр статьи: Google Scholar:

16

Шафер М. и Вернер С.: Рак как Заживающая рана: пересмотр старой гипотезы. Nat Rev Mol Cell Биол. 9: 628–638. 2008. Просмотр Статья: Google Scholar

17

Bergamaschi A, Tagliabue E, Sorlie T, Науме Б., Триулзи Т., Орланди Р., Русснес Х.Г., Несланд Дж. М., Тамми Р., Аувинен П. и др.: Сигнатура внеклеточного матрикса идентифицирует грудь подгруппы рака с различным клиническим исходом.J Pathol. 214: 357–367. 2008. Просмотр статьи: Google Scholar

18

Эмери Л.А., Трипати А., Кинг С., Кавана М., Мендес Дж., Стоун, доктор медицины, де лас Моренас А., Себастьяни П. и Розенберг CL: Раннее нарушение регуляции клеточной адгезии и внеклеточного матрикса пути прогрессирования рака груди. Am J Pathol. 175: 1292–1302. 2009. Просмотр статьи: Google Scholar:

19

Лай К.К., Шан С., Лохиа Н., Бут GC, Masse DJ, Фаусто Н., Кэмпбелл Дж. С. и Беретта Л.: внеклеточный матрикс. динамика гепатоканцерогенеза: сравнительное протеомическое исследование Трансгенные модели PDGFC и мыши с нулевым pten.PLoS Genet. 7: e10021472011. Просмотр статьи: Google Scholar:

20

Расмуссен Б. Б., Педерсен Б. В., Торп С. М. и Роза C: эластоз по отношению к прогнозу первичной молочной железы. карцинома. Cancer Res. 45: 1428–1430. 1985.

21

Франц К., Стюарт К.М. и Уивер В.М.: внеклеточный матрикс с первого взгляда. J Cell Sci. 123: 4195–4200. 2010 г. Просмотр статьи: Google Scholar:

22

Лю Ю., Карсон-Уолтер Э.Б., Купер А., Винанс Б.Н., Джонсон, М.Д. и Уолтер К.А.: Паттерны экспрессии сосудистых генов сохраняется при первичных и метастатических опухолях головного мозга.J NeuroOncol. 99: 13–24. 2010. Просмотр статьи: Google Scholar:

23

Ameur N, Lacroix L, Roucan S, Roux V, Broutin S, Talbot M, Dupuy C, Caillou B, Schlumberger M и Bidart JM: Агрессивные наследственные и спорадические медуллярные карциномы щитовидной железы демонстрируют аналогичные онкогенные пути. Endocr Relat Cancer. 16: 1261–1272. 2009. Просмотр статьи: Google Scholar

24

Бьянкини Г., Ци Ю., Альварес Р. Х., Ивамото Т., Coutant C, Ибрагим Н.К., Валеро В., Кристофанилли М., Грин MC, Радвани Л. и др.: Молекулярная анатомия стромы рака молочной железы и его прогностическое значение при положительных и отрицательных рецепторах эстрогена раки.J Clin Oncol. 28: 4316–4323. 2010. Просмотр статьи: Google Scholar

25

Лахманн Ч., Янг А.Р., Виттерн К.П. и Bergemann J: Индукция мРНК матриксной металлопротеиназы 1 и тканевый ингибитор металлопротеиназы 1 в коже человека in vivo путем смоделированное солнечное излучение. Photochem Photobiol. 73: 657–663. 2001 г. Просмотр статьи: Google Scholar

26

Гомеш Дж. Р., Омар Н. Ф., Дос Сантос Невес Дж., Narvaes EA и Novaes PD: Иммунолокализация и активность ММП-9 и ММП-2 в одонтогенной области резцов крысиного зуба после процедуры укорачивания поста.J Mol Histol. 42: 153–159. 2011 г. Просмотр статьи: Google Scholar

27

Брюммер О, Бомер Дж., Холлвиц Б., Флемминг P, Petry KU и Kuhnle H: MMP-1 и MMP-2 в шейке матки в различные стадии злокачественной трансформации — иммуногистохимический изучение. Gynecol Oncol. 84: 222–227. 2002. Просмотр статьи: Google Scholar

28

Хайнс Р.О. и Наба А. Обзор Матрисома — перечень составляющих внеклеточного матрикса и функции.Cold Spring Harb Perspect Biol. 4: a00412. Просмотр статьи: Google Scholar:

29

Фанг Т, Хоу Дж, Хэ М, Ван Л, Чжэн М, Ван X и Xia J: экстракт корня планта Actinidia chinensis (acRoots) подавляет прогрессирование гепатоцеллюлярной карциномы путем ингибирования EP3 выражение. Cell Biol Toxicol. 32: 499–511. 2016. Просмотр статьи: Google Scholar

30

Касиваги Э, Сиота М, Йокомидзо А, Ицуми M, Inokuchi J, Uchiumi T и Naito S: рецептор простагландина EP3 опосредует ингибирующее действие аспирина через андроген рецептора и способствует сопротивлению кастрации в простате раковые клетки.Endocr Relat Cancer. 20: 431–441. 2013. Просмотр статьи: Google Scholar

31

Кавада К., Хосоги Х, Соношита М., Сакасита Х., Манабэ Т., Шимахара Й, Сакаи Й, Такабаяси А., Осима М. и Taketo MM: хемокиновый рецептор CXCR3 способствует раку толстой кишки метастазы в лимфатические узлы. Онкоген. 26: 4679–4688. 2007. Просмотр статьи: Google Scholar

32

Зипин-Ройтман А, Мешель Т, Саги-Ассиф О, Шалмон Б., Авиви С., Пфеффер Р.М., Витц И.П. и Бен-Барух А.: CXCL10 способствует свойствам, связанным с инвазией, при колоректальной карциноме человека клетки.Cancer Res. 67: 3396–3405. 2007. Просмотр статьи: Google Scholar

33

Осаки М, Осимура М и Ито Х: PI3K-Akt Путь: его функции и изменения при раке человека. Апоптоз. 9: 667–676. 2004. Просмотр статьи: Google Scholar

34

Юрич Д., Кроп И., Раманатан Р.К., Уилсон Т.Р., Ware JA, Sanabria Bohorquez SM, Savage HM, Sampath D, Salphati L, Lin RS и др.: Исследование фазы I повышения дозы таселисиба, перорального Ингибитор PI3K у пациентов с запущенными солидными опухолями.Рак Discov. 7: 704–715. 2017. Просмотр статьи: Google Scholar:

35

Шульц Дж. К., Гохе Р. В., Виджесинге Д. С., Мурудкар К., Хокинс А.Дж., Шей Дж.В., Минна Д.Д. и Чалфант К.Э .: Альтернативный сплайсинг каспазы 9 модулируется фосфоинозитид-3-киназа / путь Akt через фосфорилирование SRp30a. Cancer Res. 70: 9185–9196. 2010. Просмотр статьи: Google Scholar:

36

Джин Джи, Ким MJ, Чон Х.С., Чхве Джи, Ким Д.С., Ли ЭБ, Ча Си, Юн Г.С., Ким Ч., Юнг ТХ и Пак Джи: PTEN мутации и связь с мутациями EGFR, ERBB2, KRAS и TP53 при немелкоклеточном раке легких.Рак легких. 69: 279–283. 2010 г. Просмотр статьи: Google Scholar

37

Юн МК, Митреа Д.М., Оу Л. и Кривацкий Р.В.: Регуляция клеточного цикла внутренне неупорядоченными белками p21 и p27. Biochem Soc Trans. 40: 981–988. 2012. Просмотр статьи: Google Scholar:

38

Cheng JC и Leung PC: коллаген I типа подавляет экспрессию E-кадгерина за счет увеличения PI3KCA при раке клетки.Cancer Lett. 304: 107–116. 2011. Просмотр статьи: Google Scholar

39

Ньето М.А., Хуанг Р.Й., Джексон Р.А. и Тиери JP: Emt: 2016. Cell. 166: 21–45. 2016. Просмотр статьи: Google Scholar

40

Кавалларо Ю и Кристофори Джи: Сотовый адгезия и передача сигналов кадгеринами и Ig-CAM при раке. Нат Рев Рак. 4: 118–132. 2004. Просмотр Статья: Google Scholar

41

Мин А, Чжу Ц., Ван Дж, Пэн С., Шуай Ц., Гао S, Tang Z и Su T: нокдаун киназы фокальной адгезии в фибробласты, связанные с карциномой, подавляют плоскоклеточные клетки полости рта метастазирование карциномы через подавление экспрессии MCP-1 / CCL2.J Biochem Mol Toxicol. 29: 70–76. 2015. Просмотр статьи: Google Scholar

42

Маклин Г.В., Комияма Н.Х., Серрелс Б., Асано Х, Рейнольдс Л., Конти Ф, Ходивала-Дилке К., Мецгер Д., Шамбон П., Grant SG и Frame MC: Специфическая делеция киназы фокальной адгезии подавляет образование опухолей и блокирует злокачественное прогрессирование. Гены Dev. 18: 2998–3003. 2004. Просмотр статьи: Google Scholar:

43

Канель М, Секадес П, Гарсон-Аранго М, Аллонка Э., Суарес К., Серрелс А., Фрейм М, Брантон В. и Кьяра, доктор медицины: Участие киназы фокальной адгезии в клеточной инвазии головы и плоскоклеточный рак шеи посредством регуляции MMP-2 выражение.Br J Рак. 98: 1274–1284. 2008. Просмотр статьи: Google Scholar:

44

Габриэль Б, цур Хаузен А, Стикер Э, Дитц К., Гитч Г., Фишер Д.К., Бауда Дж., Темпфер С. и Хазенбург А. Слабая экспрессия киназы фокальной адгезии (pp125FAK) у пациентов с раком шейки матки связана с плохим исходом болезни. Clin Cancer Res. 12: 2476–2483. 2006. Просмотр статьи: Google Scholar

45

Юань З., Чжэн Ц., Фань Дж., Ай К.Х., Чен Дж. И Хуан XY: Выражение и прогностическое значение фокальной адгезии киназа при гепатоцеллюлярной карциноме.J Cancer Res Clin Oncol. 136: 1489–1496. 2010. Просмотр статьи: Google Scholar

46

Рамайя С.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *