Собирается слюна во рту: Причины и методы лечения повышенного слюноотделения

Содержание

Причины и методы лечения повышенного слюноотделения

15.06.2018

Повышенное слюноотделение у взрослого – это симптом воспаления или заболевания десен, зубов или внутренних органов. Важно не только устранить обильное слюноотделение, но и верно определить его причину, иначе выздоровление будет временным.

Слюноотделение считается нормальным, если объем слюны не превышает двух литров в день. Она участвует в пищеварении, смывает с зубов кусочки еды, остатки напитков и жизнедеятельности бактерий. В норме процесс выделения слюны незаметен для человека – мы не обращаем на него внимания, как, например, на дыхание. Но если происходит сбой, то слишком большое количество слюны доставляет дискомфорт.

При этом недуге слюна накапливается во рту слишком быстро, постоянно приходится следить за тем, чтобы она не вытекла, сплевывать. Это неудобно, неэстетично, портит настроение и доставляет дискомфорт. В статье рассказываем, в чем причины повышенного слюноотделение у мужчин, женщин и как лечить.

Как понять, что слюноотделение повышено: симптомы и признаки сбоя

Слюна участвует во многих важных процессах, происходящих в организме человека. Когда все в норме, мы не замечаем, что слюна:

● помогает четко, правильно произносить слова, звуки;

● усиливает восприятие вкуса пищи, напитков;

● участвует в пищеварении – помогает пережевывать пищу, а также проглатывать ее.

Когда выделение слюны повышено, нарушается сразу несколько процессов:

● меняется вкус еды – соленая пища становится слишком выраженной, а тонкие оттенки не ощущаются;

● появляются проблемы с дикцией – выговаривать некоторые звуки проблематично;

● становится больно глотать еду.

Расположение желез

Кроме косвенных признаков, есть и четкие, измеряемые критерии. Если в течение пяти минут выделяется более двух миллилитров слюны, то пациенту ставят диагноз повышенное слюноотделение. Нормальный показатель – 2 мл.

Иногда пациенты жалуются на ложное обильное слюноотделение. Это происходит, когда во рту есть травмы, либо воспаление и может показаться, что слюны больше чем должно быть, хотя показатели в норме: 2 мл за 5 минут или 2 литров в день.

Причины повышенного слюноотделения у мужчин и у женщин

Объем выделяемой слюны контролирует нервная система. Когда со здоровьем все в порядке, это происходит естественно и незаметно для человека. Но когда возникают проблемы или появляются заболевания, процесс нарушается. Повлиять могут самые разные факторы, но чаще всего причиной повышенного слюноотделения у взрослых мужчин и женщин становится один из шести факторов.

  1. Болезни полости рта – воспаления десен, пародонтит, стоматит а еще порезы, ожоги. Когда бактерии попадают в канальцы желез, организм начинает выделять больше слюны, чтобы избавиться от них. Это естественная реакция.
  2. Проблемы пищеварительной системы – аномальная кислотность желудка, заболевания поджелудочной и печени.
  3. Болезни ЦНС – болезнь Паркинсона, повреждение тройничного нерва, бульбарный синдром, мигрень. При этих заболеваниях нарушается естественный процесс выделения слюны. Краткосрочное нарушение может возникнуть из-за воздушной, морской болезни, проблем с вестибулярным аппаратом.
  4. Гормоны – сбои гормональной системы, в частности щитовидной железы, менопауза, сахарный диабет приводят к обильному слюноотделению. Иногда такое наблюдается и у подростков во время перестройки организма.
  5. Курение, съемные протезы также могут повлиять. Оба этих явления раздражают слизистую, стимулируя гиперактивную работу желез.
  6. Прием лекарств – некоторые медикаменты имеют среди побочных действий повышенное слюноотделение или, как его еще называют, гиперсаливацию. Чаще всего это те лекарства, в составе которых есть йод или ртуть. Например: литий, физостигмин, мускарин.

Пилокарпин, нитразепам также приводят к гиперактивности желез

Что делать с повышенным слюноотделением зависит от факторов, по которым оно возникло. В некоторых случаях, например, при приеме лекарств, недуг пройдет без вмешательства врача.

Повышенное слюноотделение у женщин во время беременности

Частое основание гиперсаливации у женщин – беременность. Когда женщина готовится стать мамой, гормональный фон организма сильно меняется, а вместе с ним – многие процессы: кровообращение, пищеварение.

Беременность влияет сразу на все системы:

● эндокринную;

● нервную;

● пищеварительную.

Нередко у будущих мам возникают проблемы с зубами и деснами, например, гингивит. Это заболевание также влияет на объем выделяемой слюны.

Здоровая и воспаленная десна

Причины ночного повышенного слюноотделения у взрослых

Во время сна процессы в организме идут медленнее, в том числе и выделение слюны. Но могут происходить сбои. Вот основные факторы, приводящие к тому, что во сне выделяется слишком много слюны:

● дыхание через рот, а не через нос – часто бывает, когда человек спит на спине;

● нарушение прикуса – рот остается открытым во сне, язык пересыхает и организм решает, что нужно больше слюны;

● плохой сон – слишком крепкий сон, когда человек не уверен, что спит.

Это может привести к тому, что организм посчитает сон за реальность и будет выделять слюну как днем.

Так выглядит открытый прикус – язык выступает вперед

Лечение повышенного слюноотделения

В зависимости от причины гиперсаливации, лечением занимаются разные врачи:

● стоматологи решают проблемы местных заболеваний полости рта;

● эндокринологи при гормональных нарушениях;

● гастроэнтерологи, если дело в заболеваниях пищеварительной системы;

● неврологи, если сбой из-за проблем с ЦНС.

Выявить причину поможет стоматолог, а к конкретному специалисту направит терапевт

Лечение медикаментами

Кроме устранения причин, связанных с нарушением работы внутренних органов, врач может назначить лекарства, устраняющие симптомы. Например:

● риабал;

● скополамин;

● платифиллин.

Пить лекарства без назначения врача запрещено!

Не рекомендуем покупать и принимать лекарства без обращения к врачу.

У каждого препарата есть противопоказания и побочные эффекты: от глаукомы до заболеваний печени, сердца, сосудов.

Не стоит рисковать жизнью и здоровьем, чтобы сэкономить время или деньги на визите в клинику.

Лечение ботоксом

Для кратковременного снятия симптом иногда применяют инъекции ботокса. Он блокирует нервные сигналы, снижая активность канальцев. Этот метод помогает быстро избавиться от проблемы, но, к сожалению, эффект длится не долго.

Массаж лица и расслабление мышц

Поможет, если причина связана с нервным напряжением, стрессом или патологиями ЦНС.

Удаление желез

Назначается крайне редко, только в тех случаях, когда все остальные способы и устранение причин недуга не помогли. Удаление, даже частичное, может привести к повреждению лицевых нервов.

Народные способы

Чтобы облегчить симптомы, можно использовать народные средства. Особенно, если слюноотделение появилось из-за морской, воздушной болезни, стресса или на фоне приема лекарств.

Народная медицина предлагает два домашних рецепта для полоскания после еды:

● одну столовую ложку настойки горца перечного смешать с 200-300 мл теплой воды;

● черный чай перемешать с двумя столовыми ложками дробленной свежей малины, процедить и остудить.

Также поможет коррекция рациона: исключение картофеля, макарон, хлеба, тыквы и других крахмалистых овощей.

Запишитесь на прием в клинику СолоДент по телефону или через сайт. Определим причину повышенного слюноотделения и поможем избавиться от этого неприятного недуга.


Почему густая слюна образуется во рту после тяжелых упражнений?

Хотя плеваться отвратительно, лучше выплюнуть слюну. Как уже упоминалось выше, слюна - это способ для тела оставаться постоянным. (Гомеостаз) Когда вы занимаетесь спортом, вы сильно нагреваетесь, потому что ваши клетки быстрее дышат, чтобы производить энергию.

Пот - это способ для вашего тела снова стать холоднее, это работает, когда вода попадает на поверхность вашей кожи, затем испаряется и нагревается вместе с ней. Коса содержит много воды, но также и ферменты, которые использовались бы для переваривания пищи во рту. Так что лучше (хотя и немного противно) выплюнуть слюну. Когда вы занимаетесь спортом, вы вдыхаете намного больше воздуха за раз, его необходимо очистить перед попаданием в организм, в противном случае у вас есть риск инфекций, поэтому ваш организм вырабатывает слизь и слюну, чтобы удалить крупные молекулы пыли и бактерии. Когда вы занимаетесь спортом, ваше тело впитывает намного больше воздуха в более быстром темпе, поэтому вы производите больше слизи, чтобы помочь очистить его. Важно, чтобы вы регулярно сморкались, чтобы избавиться от избытка и старой слизи, которая полна бактерий и частиц пыли из воздуха. Глотание слюны полностью идет вразрез с слизью, так как пыль и бактерии могут попасть в ваше тело в любом случае! Поэтому следите за тем, чтобы не глотать слюну и регулярно сморкаться при выполнении упражнений.
Убедитесь, что вы также пьете жидкость во время / после тренировки, чтобы заменить уровень воды, который ушел. Вы должны быть на 80% состоят из воды, поэтому важно пить воду, чтобы все процессы в организме работали должным образом. Надеюсь это поможет! Важно, чтобы вы регулярно сморкались, чтобы избавиться от избытка и старой слизи, которая полна бактерий и частиц пыли из воздуха. Глотание слюны полностью идет вразрез с слизью, так как пыль и бактерии могут попасть в ваше тело в любом случае! Поэтому следите за тем, чтобы не глотать слюну и регулярно сморкаться при выполнении упражнений. Убедитесь, что вы также пьете жидкость во время / после тренировки, чтобы заменить уровень воды, который ушел. Вы должны быть на 80% состоят из воды, поэтому важно пить воду, чтобы все процессы в организме работали должным образом. Надеюсь это поможет! Важно, чтобы вы регулярно сморкались, чтобы избавиться от избытка и старой слизи, которая полна бактерий и частиц пыли из воздуха. Глотание слюны полностью идет вразрез с слизью, так как пыль и бактерии могут попасть в ваше тело в любом случае! Поэтому следите за тем, чтобы не глотать слюну и регулярно сморкаться при выполнении упражнений.
Убедитесь, что вы также пьете жидкость во время / после тренировки, чтобы заменить уровень воды, который ушел. Вы должны быть на 80% состоят из воды, поэтому важно пить воду, чтобы все процессы в организме работали должным образом. Надеюсь это поможет! Глотание слюны полностью идет вразрез с слизью, так как пыль и бактерии могут попасть в ваше тело в любом случае! Поэтому следите за тем, чтобы не глотать слюну и регулярно сморкаться при выполнении упражнений. Убедитесь, что вы также пьете жидкость во время / после тренировки, чтобы заменить уровень воды, который ушел. Вы должны быть на 80% состоят из воды, поэтому важно пить воду, чтобы все процессы в организме работали должным образом. Надеюсь это поможет! Глотание слюны полностью идет вразрез с слизью, так как пыль и бактерии могут попасть в ваше тело в любом случае! Поэтому следите за тем, чтобы не глотать слюну и регулярно сморкаться при выполнении упражнений. Убедитесь, что вы также пьете жидкость во время / после тренировки, чтобы заменить уровень воды, который ушел.
Вы должны быть на 80% состоят из воды, поэтому важно пить воду, чтобы все процессы в организме работали должным образом. Надеюсь это поможет!

Логопед

Преодоление гиперсаливации у детей с дизартрией

Уважаемые родители! Поговорим о преодолении такого симптома дизартрии, как гиперсаливация. С каждым годом в силу различных причин детей  с  дизартрией становится все больше и больше. У таких детей, как правило, наблюдается повышенное слюнотечение, особенно это заметно при речевой нагрузке.

Что такое гиперсаливация?

Гиперсаливация-  это обильное  слюнотечение. Этот симптом  может быть связан с повышенным слюноотделением, но чаще всего она является причиной того, что слюна, которая образуется,  просто вовремя не проглатывается. При дизартрии  всё происходит именно так. Понять это можно, попросив ребенка открыть рот и посмотреть, как, буквально через 8-10 секунд, во рту скапливается слюна, при разговоре ребенок брызгает слюной, и у него часто бывают мокрыми от слюны губы.

 

Что же можно предпринять в домашних условиях, чтобы помочь ребенку преодолеть этот неприятный симптом?

1. Учим ребенка проглатывать слюну.

1). Ребёнка учат подсасывать слюну с сомкнутыми губами, а потом учат глотать её. Сначала это делается с запрокинутой головой, а потом в нормальном положении.

2). Ребёнку постоянно делается  напоминание о необходимости проглатывания слюны перед речью или перед артикуляционным упражнением.

3). В некоторых случаях используется промакивание рта салфеткой.

4). У детей-дизартриков очень часто рот приоткрыт. Поэтому  ребёнка учат держать рот закрытым, если он не разговаривает и не принимает пищу.

5). На индивидуальном занятии при работе с дизартриком нужно специально делать паузы, чтобы ребёнок мог проглотить скопившуюся слюну.

6). Важно научить ребёнка с гиперсаливацией дифференцировать ощущения сухого и мокрого подбородка.

2.Упражнения артикуляционной и мимической гимнастики.

1.Имитация зевания, жевания, глотания с запрокинутой головой. (Жевание и глотание рекомендуется производить с закрытым ртом).

2.«Птенчики» («Окошечко»). Открыть рот широко и удерживать его в таком положении в течение 3-5 секунд. Закрыть рот. Язык при выполнении упражнения спокойно лежит на дне ротовой полости. Удерживать рот открытым в течение 5-10 секунд.

3.«Усики». Удерживать губами полоску бумаги, трубочки для коктейля разных диаметров, деревянный или металлический шпатель, пузырьки из-под лекарств разных диаметров.

4.«Толстячки – худышки». Надувание обеих щёк одновременно. Втягивание щёк в ротовую полость при открытом рте и сомкнутых губах.

5.«Шарики». Надувать попеременно щёки 4-5 раз.

6.«Упражнение для йогов» — рот открыт, ребенок вращает языком в преддверии рта, затем логопед предлагает ему сглотнуть слюну.

3.Активизация мышц с использованием мёда или хлебного шарика.

1. Положить на  кончик языка хлебный шарик (измельчённые витамины, накапать из пипетки 1-2  капли сиропа), с усилием сделать глотательные движения.

2. На кончик языка капнуть капельку мёда. Выполнять упражнение «Часики» или делать  движения языком вперёд-назад.

4. Произнесение гласных: а, э, и на твёрдой атаке для активизации мышц мягкого нёба.  

  • а а а; э э      э; и и и;
  • аэ, аэ, аэ;      эа, эа, эа; аи, аи, аи; эи, эи, эи;
  • аэи, аэи,      аэи.

Очень полезно при гиперсаливации жевание и глотание твёрдой пищи (твёрдых овощей и фруктов, сушек, сухариков).

5. Полоскание рта.

Некоторые авторы предлагают использовать полоскания полости рта травами (настоем шиповника, коры дуба, тысячелистника. Это возможно, если у ребёнка нет аллергии.

Поэтапное полоскание горла минеральной водой, жидким киселём, кефиром, густым киселём.

Желаю Вам успехов в преодолении гиперсаливации у Вашего ребенка!

                                                                                              Учитель-логопед Е.В. Ессина

Повышенное слюноотделение | Приазовський робочий, Маріуполь

Повышенное слюноотделение может произойти при виде еды, во время приема пищи – и это естественно. Однако иногда такой симптом может быть связан и с некоторыми определенными состояниями организма или даже с заболеваниями. Процесс выделения слюны является необходимой и важной функцией слюнных желез. В норме каждые 5 минут должно выделяться около 1 мл слюны, но иногда ее вырабатывается гораздо больше.

Причины повышенного слюноотделения

Увеличение выработки слюны чаще всего наблюдается при воздействии некоторых условных раздражителей: запаха, вида еды. Обычное слюноотделение должно происходить и при отсутствии каких-либо факторов – этот процесс необходим для поддержания слизистой ротовой полости во влажном состоянии, а также для нормального пищеварения.

Когда слюна выделяется в больших количествах, чем это необходимо, говорят о повышенном слюноотделении, или так называемой гиперсаливации. Можно назвать несколько факторов, способствующих развитию такого состояния: использование некоторых лекарственных средств, побочным проявлением которых может быть повышенное выделение слюны; расстройство обменных процессов; неврологические заболевания; острые отравления или токсикоинфекции; оториноларингологические патологии.

Иногда повышение выработки слюны может наблюдаться в подростковом возрасте. Такое состояние не является патологией, это всего лишь следствие изменения гормонального фона в период полового созревания.

Тем не менее доказано, что с течением времени у взрослых пациентов выделение слюны постепенно снижается, так как возрастные изменения могут угнетать работу секреторных желез.

Гиперсаливация часто встречается у лиц со стоматологическими проблемами, однако после лечения зубов выделение слюны, как правило, нормализуется.

Усиление выработки слюны также наблюдается у тех людей, которые много курят: слюноотделение провоцируется, в первую очередь, никотином и смолами, а также табачным дымом, который раздражает слизистую и рецепторы желез.

Повышение слюноотделения может наблюдаться при патологиях системы пищеварения (например, при язве желудка), при паразитарных инвазиях, у женщин во время беременности, при нервных заболеваниях (рак мозга, ишемия, паркинсонизм, шизофрения и др.).

Симптомы повышенного слюноотделения

Пациенты обычно жалуются на повышенную чрезмерную выработку слюнной жидкости в ротовой полости, рефлекторное желание постоянно сплевывать. При обследовании обнаруживается повышение секреторной функции слюнных желез более 5 мл за 10 минут (при норме – 2 мл).

В отдельных случаях повышение слюноотделения связано с расстройством функции глотания вследствие воспаления в ротовой полости, травмы языка, нарушений иннервации бульбарных нервов. При этом количество слюны находится в пределах нормальных показателей, однако у пациентов появляется обманное ощущение избыточного слюноотделения. Такие же симптомы характерны и для больных с навязчивыми состояниями.

Иногда повышенное отделение слюны может сочетаться с изменением вкусовых ощущений, с понижением, повышением или извращением чувствительности вкуса.

Повышенное слюноотделение ночью

В норме во сне должно производиться меньшее количество слюнной жидкости, чем в период бодрствования. Но иногда слюнные железы просыпаются раньше, чем человек: в такие моменты мы можем наблюдать стекание слюнной жидкости у спящего. Если такое встречается не часто, поводов для беспокойства нет. Зачастую выделение слюны ночью связано с отсутствием носового дыхания (при простудах, заложенности носа): после восстановления проходимости носовых путей слюноотделение изо рта прекращается. Также слюноотделение ночью может быть связано с неправильным прикусом, отсутствием зубов: такие проблемы решаются посещением стоматолога. Когда человек спит достаточно крепким сном, он может в какой-то момент потерять контроль над своим организмом, что проявляется в виде повышения слюнотечения.

Лечение повышенного слюноотделения народными средствами

Иногда при отсутствии серьезных причин повышенного слюноотделения можно воздействовать на патологию применением народных средств: экстракт или настойка водяного перца (продается в аптеке). Развести столовую ложку настойки в стакане воды, полоскать ротовую полость после каждого приема пищи; лагохилус опьяняющий. Взять 20 г листьев растения, залить 200 мл горячей воды, нагреть на водяной бане в течение 15 минут, охладить и процедить. Полоскать рот несколько раз в день после еды; ягоды калины. Плоды толкут в ступке, заливают кипящей водой (2 столовые ложки плодов на 200 мл воды), через четыре часа процедить и использовать для полоскания полости рта, можно добавлять в чай и пить несколько раз в сутки; настойка пастушьей сумки. Разводят 25 капель настойки в 1/3 стакана воды и полощут ротовую полость после каждого приема пищи.

Можно полоскать рот отваром ромашки, настоем коры дуба, любым растительным маслом. Рекомендуется чаще чистить зубы, избегать крахмалистой пищи, употреблять витаминные комплексы.

Хороший эффект дает употребление несладкого чая или воды с добавлением лимонного сока.

Если народные советы не помогают, не теряйте времени и обратитесь к врачу: возможно, причина слюнотечения лежит гораздо глубже, что требует дополнительной диагностики и квалифицированного лечения.

Почему у собаки обильно текут слюни изо рта - Здоровье Животных

Собаки живут рядом с человеком более 10 тысяч лет. За это время люди искусственно вывели около 400 пород, от крошечных комнатных до массивных служебных. Собаки разных пород обладают обширным набором физиологических особенностей, среди которых и склонность к слюноотделению.

Естественный для всех млекопитающих секрет слюнных желёз выполняет в организме животного важные функции – формирует защиту ротовой полости от проникновения болезнетворных бактерий, способствует более тщательному перевариванию и усвоению пищи, увлажняя и размягчая её. Но бывает и так, что обильное выделение секрета слюнных желез, гиперсаливация сигнализирует о проблемах со здоровьем питомца.

Существует целый ряд пород собак,для которых гиперсаливация является естественной функцией, обуславливается особенностями анатомического строения – массивной головой с укороченной челюстью, рыхлыми брылями. К ним относятся доги, боксёры, бульдоги, шарпеи, мастифы, ньюфаундленды, сенбернары, кавказские овчарки.

Если у собаки текут слюни, это может быть естественным физиологическим проявлением. Нормой считаются следующие причины обильного выделения слюны:

  • Жарким днём организм животного проявляет защитную реакцию на перегрев;
  • Высокие физические нагрузки;
  • Естественная реакция на запах пищи;
  • У самок во время беременности;
  • У щенков при смене зубов;
  • Реакция на медикаментозное вмешательство.

При этом следует учитывать, что согласно наблюдениям врачей нормальным считается выделение слюны в объёме не более 1 литра в сутки. Если постоянно и слишком обильно текут слюни у собаки, причина может заключаться в патологических изменениях, наличии заболеваний. Особенно, если слюноотделение сопровождается другими тревожными симптомами.

О причинах гиперсаливации у собак

Секрет слюнных желёз, которые располагаются под языком, челюстью, возле ушей поступает в ротовую полость. Если у собаки слюни текут, как вода, то есть с заметным превышением нормы, это говорит о нарушениях естественных функций желёз, чрезмерной выработке ими секрета.
Способствовать этому может обширный ряд физиологических и психологических факторов. Слюни сильно текут у собаки, переживающей стрессовые ситуации – разлуку с хозяином, особенно продолжительную, смену постоянного места жительства, появление в доме ещё одного питомца, частые и необоснованные наказания от хозяев.

Сильное психическое и эмоциональное переживание может вызывать у собаки поездка в ветеринарную клинику. Умное животное догадывается о том, что визит к врачу не сулит ему ничего приятного, волнение вызывает гиперсаливацию. По той же причине слюноотделение может усиливаться перед приёмом лекарственных препаратов.

Избыточное выделение секрета слюнных желёз вызывается наличием у животного ряда патологий, заболеваний:

  • стоматологические болезни, такие как кариес, пародонтоз, зубной камень переносятся животным болезненно;
  • вывих челюсти, неправильный прикус;
  • травмы ушей, воспалительные процессы в ушных раковинах способствуют усилению слюноотделения, ведь возле ушей расположены большие слюнные железы;
  • гиперсаливация может свидетельствовать о возникновении вирусной инфекции. Такие болезни, как чума плотоядных, бешенство, парвовирусный энтерит собак чрезвычайно опасны, при малейших подозрениях необходимо срочно обратиться к врачу;
  • хронические патологии внутренних органов – печени, почек, желудочно-кишечного тракта, опухоли и язвы;
  • отравление, интоксикация от испарений бытовой химии;
  • аллергические реакции, сопровождающиеся характерными симптомами – чиханием, одышкой, зудом, насморком;
  • при гельминтозе повышенное отделение слюны дополнительно может сопровождаться рвотой.

Причинами появления гиперсаливации так же могут быть эпилепсия, черепно-мозговая травма, тепловой удар, опухоли слюнных желёз, портосистемный шунт, нарушения в иммунной системе.

Наиболее характерные симптомы

Чтобы дать ответ на вопрос «почему у собаки текут слюни» необходимо выяснить, симптомами каких заболеваний является гиперсаливация в каждом конкретном случае. Например, если собака не ест, текут слюни, пёс опускает голову, рычит, поскуливает, это может указывать на проблемы в сфере стоматологии.

В случае если у собаки текут слюни и слабость, жар и усиление жажды – симптомы характерны при инфицировании вирусными инфекциями. Когда у питомца жажда и жар сопровождаются рвотными позывами, диареей, высока вероятность отравления. Разнообразие причин гиперсаливации обуславливают и различия в клинической картине.

Владельцам собак важно помнить – если помимо гиперсаливации присутствуют другие признаки, указывающие на проблемы со здоровьем питомца, необходимо срочно обращаться в ветеринарную клинику. Только квалифицированный врач сможет поставить точный диагноз, назначить эффективное лечение. В случаях, связанных с вирусными инфекциями, промедление может быть опасно для жизни питомца.

Диагностика при усиленном слюноотделении

При обращении в ветеринарную клинику с подозрением на гиперсаливацию у собаки важно иметь при себе паспорт прививок, подтверждающий наличие иммунитета к определённым заболеваниям. Врачу необходимо, в первую очередь, исключить заражение бешенством, как причину усиленного слюноотделения.

Диагностика в клинике включает полный физический и неврологический осмотр пациента, проведение ряда клинических исследований. Исследуются общий и биохимический анализы крови, анализ мочи, кала, проводится УЗИ, рентген. При наличии подозрений на нарушения иммунной системы проводится биопсия.

Помимо проведения диагностических мероприятий существенную помощь в определении причин, почему у собаки текут слюни изо рта, могут оказать сведения об образе жизни, контактах с другими животными, подробности о содержании, кормлении питомца, используемых хозяевами медицинских препаратах.

Лечение

Общую стратегию лечения врач вырабатывает на основании точного диагноза, с учётом состояния здоровья, возраста животного и прочих индивидуальных факторов. В случае, когда причиной повышенного слюноотделения являются посторонний предмет, застрявший в пасти, опухоль или рана, применяются хирургические методы лечения.

Гиперсаливация является симптомом одного из перечисленных выше заболеваний, её устранение проводится параллельно с лечением диагностированной в клинике болезни. Терапевтические методы и препараты назначаются в зависимости от клинической картины, могут включать антибиотики, противовирусные средства, методики поддерживающей терапии.

О Профилактике обильного слюноотделения

Самым действенным профилактическим средство является своевременная вакцинация животного. К основным профилактическим мероприятиям так же относятся санитарные нормы содержания собак, гигиена кормления, регулярные противопаразитарные процедуры. Важно максимально ограничить контакты питомца с бродячими животными.
При обнаружении у собаки непрекращающегося обильного слюноотделения, следует немедленно обратиться к ветеринарному врачу. Своевременно установленный диагноз, оперативная врачебная помощь существенно повышают шансы на полное выздоровление.

Запах изо рта: причины, как убрать

Вы сидите в офисе на совещании, как вдруг что-то привлекает ваше внимание. Это девушка из бухгалтерии, которая сидит рядом с вами. Вы понимаете, что во время обеда она ела лук, и даже не догадывается, что кусочек лука в лаваше, который она съела час назад, заставляет людей на совещании медленно отодвигать свои стулья подальше.

Дурной запах изо рта — более распространенное явление, чем вы думаете. По словам доктора Гарольда Катца (Harold Katz), треть населения земли страдает дурным запахом изо рта, а некоторые даже об этом не знают. «Потому что вы не можете почувствовать запах собственного дыхания», говорит он, добавляя, что мозг привыкает к запаху — процесс, называемый акклимацией.

Катц — основатель клиники дыхания в Калифорнии, утверждает, что пища, которую вы едите, имеет непосредственное влияние на то, какой запах исходит из вашего рта.

Согласно Американской Ассоциации Дантистов, запах присутствует до тех пор, пока пища не будет удалена из организма. Таким образом, с того момента, когда вы съедаете кусочек чесночной булочки, этот кусочек попадает в кровь, затем переносится в легкие, и затем выводится — все это время вы будете источать запах. Очевидно, что такие вещи, как чеснок, лук и карри могут повлиять на дыхание непосредственно, так как они содержат сернистые соединения — именно они и являются причиной неприятного запаха. Но, как говорит Катц, есть и менее очевидные источники запаха, из-за которых ваше дыхание может заставить всех покинуть комнату.

Бактерии во рту

То, что неприятный запах исходит из желудка — миф. Практически всегда причиной запаха являются бактерии, которые живут под языком, в гортани и под миндалевидными железами. Некоторые продукты могут стать косвенной причиной запаха, потому что они дают топливо анаэробным бактериям, которые производят серу и являются источником запаха. Причиной могут также послужить такие продукты, как молоко, сыр и йогурт. «Они содержат белки, которые эти мерзкие бактерии используют в качестве топлива для выделения запаха».

Для свежести дыхания важно и то, что вы пьете

Кофе — это кислотная жидкость, а бактерии обожают кислотную среду, так как в ней они быстрее размножаются. Конфеты и жевательная резинка, содержащие сахар, также являются источником проблем, потому что бактерии питаются сахаром. Напитки для взрослых Катц не рекомендует, потому что алкоголь высушивает ротовую полость, позволяя бактериям размножаться.

Те, кто следят за потребляемыми калориями, должны проявлять осторожность. «Когда вы на диете, количество слюны сокращается, а вместе с ней сокращается и естественная защита», говорит Катц. А когда организм начинает разлагать накопленные жиры, это тоже может стать причиной неприятного запаха. Известно, что эта проблема часто возникает у бодибилдеров, потому что они потребляют много белка молочной сыворотки, который помогает им наращивать мышцы. В этом белке содержатся высокие концентрации аминокислот, которые в свою очередь содержат большое количество серы. «Если вы придерживаетесь высокобелковой диеты, бактерии разлагают аминокислоты на белки, в результате чего появляется неприятный запах».

Вода смывает неприятный запах

Катц утверждает, что лучшее средство от неприятного запаха — выпивать от шести до восьми стаканов воды в день. Чай тоже помогает.

Слюна является естественным средством поддержания свежести дыхания

«Слюна содержит кислород, который является естественным врагом анаэробных бактерий», говорит он. «Чем больше слюны, тем свежее ваше дыхание». Помогает и пища, содержащая много воды: сельдерей, огурцы, виноград, кабачки и морковь. Сочная пища, такая как арбуз и клубника, тоже помогает защититься от бактерий, потому что она стимулирует выработку слюны. Если вы не можете устоять перед чесноком, луком и другой «пахучей» едой, то прополощите рот специальным раствором, насыщенным кислородом, и почистите зубы. По словам Катца, кислородные соединения, содержащиеся в растворе для полоскания рта и зубной пасте, соединяются с серными соединениями и создают непахучие соединения. Растворы для полоскания рта, содержащие спирт, не обеспечивают желаемого результата, потому что сушат рот.

Завтрак имеет значение

Катц рекомендует завтракать каждый день. Он говорит, что тот, кто пропускает завтрак, рискует получить неприятный запах, потому что утренний прием пищи сразу же стимулирует выработку слюны.«Когда вы спите, слюна не вырабатывается, поэтому во рту буквально открывается фабрика по производству серы, которая работает в течение 7-8 часов, потому что нет ни слюны, ни кислорода, чтобы бороться с бактериями».И как с самого первого визита говорит ваш дантист: чистка зубов представляет собой отличную защиту. Пища собирается между зубами, на языке и вокруг десен. Затем она начинает гнить, источая неприятный запах.

Из-за еды вы не будете пахнуть плохо вечно. «Как только появляется слюна, у большинства свежее дыхание восстанавливается», говорит Катц.

Почему у кота текут слюни изо рта - почему у кошки текут слюни

Повышенное слюноотделение может служить симптомом болезни.

Не так часто, но все же некоторые владельцы кошек могут отметить у своих питомцев чересчур обильное слюноотделение. О чем это может говорить?

В выделении слюны у животного нет ничего патологического. Эта жидкость выполняет ряд важнейших для нормального жизнеобеспечения животного функций. В том числе защитная — предохранение слизистых рта, десен, языка и зубов от механических воздействий различного генеза, пищеварительная — снабжение, размягчение и обеспечения облегченного транспорта пищи в пищеварительный тракт. Так что выделение слюны у кошки — процесс естественный, и многие хозяева его даже не замечают. Но что делать, если слюноотделение настолько обильное, что владелец питомца стал обращать на это внимание?

Каковы признаки чрезмерного слюноотделения?
Если хозяин стал замечать, что кошка слишком часто и усердно вылизывается, а подбородок и шея — мокрые, а также шерсть на груди влажная и приобрела вид сосулек — это сигнал для тревоги. Стоит обратить пристальное внимание на поведение кошки: если питомец вытирается о мебель, на месте, где спит кошка, обнаруживаются мокрые пятна или лужи, стоит незамедлительно принимать меры.

Если саливация, или слюноотделение, слишком обильная, это может указывать лишь на проблемы со здоровьем питомца. Причиной проявления этого процесса могут стать различные расстройства. Так, например, в основе может лежать заражение различными вирусными заболеваниями (например, бешенство), которые в том числе сопровождаются повышенной температурой тела и обильным потреблением питомцем воды, тошнотой.

Другой причиной может быть отравления различного генеза, от пищевого до химического. Важно в этом случае определить, на что именно была получена данная реакция, сопровождаемая также рвотой, изменением консистенции стула.

Также причиной повышенного слюноотделения могут быть заболевания непосредственно ротовой полости, зубов, десен. Данные расстройства будут сопровождаться, в том числе, очевидной болезненностью при приеме животным пищи.

Причиной обильной саливации может быть также наличие инородных объектов в ротовой полости, горле или пищеводе (остатки пищи, части игрушек, шерсть). Хронические заболевания, расстройства пищеварительного тракта, онкологические заболевания и даже гельминты могут стать причиной повышенного слюноотделения.

Самостоятельно делать поспешные выводы не стоит. Само по себе обильное слюноотделение не является болезнью, но в сочетании с другими симптомами указывает на наличие определенного заболевания, констатировать которое может только ветеринарный врач после проведения и расшифровки специальных анализов. Владельцу остается своевременно обратиться за помощью к специалисту и, приняв во внимание наставления ветеринарного врача, начинать лечение питомца.

SPARK от аутизма | Собрать слюну сложно - вот несколько способов облегчить задачу

Эмили Сингер

Дата публикации: 19 марта 2020 г.

Для Натали Куску, матери девочек-близнецов, страдающих аутизмом, самой сложной частью работы в СПАРК был сбор образцов слюны. Слюна - важный компонент исследований СПАРК. Ученые собирают ДНК из слюны, а затем анализируют ДНК на предмет изменений генов, связанных с аутизмом.

Близнецы Куску молоды, и их легко одолеть, поэтому она беспокоилась, что они не смогут завершить процесс.На сбор необходимой чайной ложки вертела может уйти до получаса. Куску помогал сотрудник Детского центра аутизма Сиэтла, который разработал различные стратегии сбора слюны у детей.

Сотрудник иногда считает или поет, чтобы отвлечь их или уменьшить стресс. Тем, кому особенно тяжело, она может распределить процесс на несколько сеансов. Она покажет им губку для сбора и потренирует первые шаги процесса, чтобы помочь им освоиться.В случае Куску она взяла образец, когда девочки спали в своих автомобильных креслах.

Если у вас возникают проблемы со сбором слюны, вот несколько полезных советов.

Рассмотрим где брать пробу

  • Выберите место, которое мало отвлекает и где вы или ваш ребенок можете сесть, например стул, диван или стол.

Решите, какой метод использовать для сбора пробы

  • Сможете ли вы или ваш ребенок производить около чайной ложки слюны? Если нет, попробуйте собрать его губкой.В комплект входят инструкции по обоим методам.

Подумайте, как во время процесса подбодрить вашего ребенка или другого человека

  • Используйте несъедобные награды, такие как пузыри, предпочтительную игрушку, раскраску или таблетку во время или после сбора.
  • Позвольте пациенту выбрать специальную закуску ПОСЛЕ того, как он сдаст образец слюны. Важно не есть за 30 минут до или во время сбора.
  • Сделайте сбор слюны веселым и увлекательным! Используйте МНОГО похвалы и подкрепления.
    • Ободряйте и предлагайте словесную похвалу или дайте пять, когда человек плюет или терпит губку.
    • Слава усилиям и маленьким успехам. Это придает импульс и помогает человеку чувствовать себя успешным во время сбора слюны.
    • Некоторые люди хорошо относятся к сбору слюны как к игре. Например, среди членов семьи может быть «гонка» за наполнение своих тюбиков.
  • Обеспечьте выбор. Позвольте человеку выбрать:
    • Где они хотят сидеть - например, на конкретном стуле или в комнате - во время процесса.
    • Стоять или сидеть.
    • Какой игрушкой они хотят поиграть во время сбора.
    • Какую награду они хотят потом.
  • Делайте перерывы по мере необходимости, чтобы свести к минимуму разочарование и усталость.

Для сбора губкой

Для выработки слюны

  • Поместите губку в те части рта, которые производят больше всего слюны.
    • Поместите губку под язык или рядом с одной из губок.
  • На внешней стороне рта стимулируйте выработку слюны, осторожно потирая щеки за задними зубами.
    • Любая стимуляция вкуса, запаха или жевательных движений челюсти также способствует образованию большего количества слюны.
  • Оставайтесь гидратированными
    • Хорошее обезвоживание в течение дня и питьевая вода перед забором (но не в течение 30 минут перед забором) также могут помочь в производстве слюны.

Перерывы

  • Попросите человека положить губку в рот на 30 секунд - 1 минуту, чтобы получить короткий перерыв на 1-2 минуты. Предложите игрушку или другое полезное занятие во время перерывов.
  • Четко объясните, как получать перерывы или вознаграждения. Используйте стратегии «первым - потом», например:
    • «ПЕРВЫЙ сплевываешь губкой, ЗАТЕМ получаешь пузыри».
  • Используйте стратегии подсчета, такие как:
    • «Плюните еще 3 раза, и тогда мы сделаем перерыв.’
    • Сосчитайте до 10 с губкой во рту и сделайте перерыв.
  • Это также дает вам время удалить с губки слюну.
  • Повторяйте этот процесс до тех пор, пока у вас не будет достаточно слюны, чтобы заполнить ее до линии на пробирке для сбора.

Отвлечение может помочь

  • Приятные задачи, например просмотр фильма на планшете, могут помочь отвлечь внимание людей, которым тяжело.
    • Предложите человеку открыть рот и взять губку во время просмотра фильма.
    • Если человек отказывается от губки, приостановите просмотр фильма, пока он не примет ее. Или попробуйте одну из других стратегий, например, стратегию «первым - потом», упомянутую выше.

Разбейте процесс на этапы

  • Некоторые люди с аутизмом беспокоятся о новом. Может быть полезно знакомить с каждым этапом процесса и поощрять его, чтобы люди постепенно к нему привыкли.
  • Например, для начала попросите человека открыть рот и быстро прикоснуться губкой к губам.Затем быстро коснитесь губкой внутренней части рта или языка. Постепенно повышайте терпимость к длительному пребыванию губки во рту.
  • Подкрепляйте и хвалите каждый успешный шаг во время сбора слюны.

Получите как можно больше слюны из губки

  • После того, как губка соберет слюну, поверните губку в верхней части трубки, чтобы выжать как можно больше слюны, а не соскабливать.

Узнайте больше, посмотрев видео из нашей коллекции

Посмотрите видеоролики о сборе слюны SPARK на YouTube.

Стратегии управления рисками и ошибками

Int J Med Sci. 2018; 15 (8): 823–831.

Каши Радж Бхаттараи

1 Кафедра фармакологии и Институт разработки новых лекарств, Школа медицины, Национальный университет Чонбук, Чонджу, Республика Корея;

Хён-Рён Ким

2 Высшая школа, Институт науки и технологий Тэгу Кёнбук (DGIST), Тэгу, 42988, Республика Корея.

Хан-Чжун Ча

1 Кафедра фармакологии и Институт разработки новых лекарств, Школа медицины, Национальный университет Чонбук, Чонджу, Республика Корея;

1 Кафедра фармакологии и Институт разработки новых лекарств, Школа медицины, Национальный университет Чонбук, Чонджу, Республика Корея;

2 Высшая школа, Институт науки и технологий Тэгу Кёнбук (DGIST), Тэгу, 42988, Республика Корея.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Поступило 25.01.2018 г .; Принято 14 апреля 2018 г.

Авторские права © Ivyspring International Publisher Эта статья цитируется в других статьях в PMC.

Abstract

Технологии биологии слюны, такие как электрофорез, широко применяются для диагностики системного состояния здоровья. Диагностика с использованием образца слюны стала предпочтительной техникой, поскольку образец легко собрать, а метод является недорогим и неинвазивным.Диагностика слюны даже была идентифицирована как потенциальная замена биомаркеров сывороточного белка. Однако оптимальный протокол сбора слюны еще не установлен. Во многих научных условиях, таких как рандомизированные контролируемые исследования, часто возникают ошибки выборки и статистические ошибки при работе с образцами от здоровых добровольцев. Эти ошибки могут быть связаны с психологическим поведением добровольцев, несоблюдением режима лечения, характеристиками анкеты, методами сбора и / или обработкой выборки.Цель представленного здесь обзора - обрисовать стратегии управления факторами риска и минимизировать ошибки отбора проб во время сбора слюны у здоровых добровольцев.

Ключевые слова: Сбор слюны, здоровые добровольцы, протеомика слюны, психологический стресс, ошибки отбора проб, управление рисками

Введение

Слюна - важный образец в стоматологических исследованиях и в области физиологии полости рта из-за ее пригодности в качестве непригодного инвазивный диагностический инструмент.Слюна использовалась для диагностики различных аутоиммунных заболеваний, диабета, сердечно-сосудистых заболеваний, кариеса и других заболеваний полости рта 1 - 3 . Объем и биохимический состав слюны у разных людей различаются; на эти параметры влияют возраст 4 , пол 5 и диета 6 . Возраст и скорость слюноотделения напрямую влияют на активность альфа-амилазы слюны у здоровых людей 4 . Значительно меньше нестимулированной цельной слюны наблюдалось у здоровых женщин с протезами, не принимавших лекарства, по сравнению с их коллегами-мужчинами 7 .Получение слюны происходит быстро, просто и безболезненно, что делает этот образец несложным инструментом для скрининга болезней 8 . Однако сбор образцов должен быть соответствующим образом оптимизирован, чтобы уменьшить ошибку 9 . Например, метод сбора и продолжительность сбора могут повлиять на измерения активности кортизола и амилазы слюны 9 . Методы сбора и обработки также влияют на измеренную концентрацию общего белка, а также на концентрацию С-реактивного белка и иммуноглобулина (IgA) 8 .Различные факторы, такие как используемые методы анализа и стандарты, влияют на результаты, полученные при оценке слюнной жидкости. Например, образцы слюны, очищенные центрифугированием, показывают более низкие концентрации лизоцима, чем их аналоги в цельной слюне. Кроме того, было показано, что метод анализа на лизопланшете дает более высокие концентрации лизоцима, чем турбидиметрический анализ 10 . Более того, скорость секреции слюны у здоровых людей различна. Поскольку объем различается у разных людей, скорость потока слюны и другие биомаркеры слюны различаются от человека к человеку.В этом обзоре основное внимание уделяется процедуре сбора слюны, факторам, способствующим возникновению ошибки, и стратегиям управления ошибками.

Важность протеомики слюны в биомедицинских технологиях

Исследования, основанные на протеомике слюны, в настоящее время возникают из-за интереса к идентификации прогностических биомаркеров для нескольких физиологических и патологических состояний. Диагностика слюны облегчает раннее обнаружение и диагностику нескольких уровней гормонов и заболеваний полости рта, а также используется для дифференциации пациентов с нормальным контролем и пациентов с системными заболеваниями.Более 3000 белков и пептидов были охарактеризованы с использованием новейших протеомных технологий в слюне человека 11 . В протеоме слюны 12 были исследованы различные состояния и недуги, такие как воспалительные заболевания полости рта, плоскоклеточный рак полости рта, заболевания пародонта, сахарный диабет, СПИД, гепатиты B и C, муковисцидоз и системный склероз. Несколько биомаркеров слюны для диагностики рака полости рта, включая CD44, CD59, антитела p53, M2BP (опухолевый антиген), MRP14, профилин, гистон h2, моэзин, инволюкрин, каталазу, трансферрин, цинковый палец слюны, специфические нитрозамины табака, кератин 36 и цистатин A были исследованы с использованием различных протеомных инструментов, которые были рассмотрены в предыдущих статьях 12 - 14 .Аналогичным образом, NF-kB-зависимые цитокины и иммуносупрессивные цитокины, такие как IL-4, IL-10, IL-13 и IL-1RA, были идентифицированы как потенциальные биомаркеры пренеопластических поражений полости рта и OSCC 15 , 16 . При воспалительных заболеваниях присутствуют различные протеомы слюны; например, синдром Шегрена включает лактоферрин, β2-микроглобулин, полимерный рецептор Ig, лизоцим C, легкую каппа-цепь Ig, цистатин C, карбоангидразу VI и амилазу слюны 17 .Точно так же протеомика слюны также способствовала раннему выявлению и пониманию нейропсихиатрических заболеваний, например аутизма, снижения когнитивных способностей и депрессии 18 . Высокотехнологичные протеомные инструменты, включая HPLC, ELISA, иммуноблот, LC / MS, масс-спектрометрию, 2D-электрофорез, протеомику на основе MS, технологию MALDI-TOF MS, ПЦР, иммуно-радиометрический анализ и многие другие, используются для идентификации нескольких биологических маркеров. 13 .

Рекомендации по отбору проб

Требования к отбору проб

Хотя для сбора слюны не требуется обширная подготовка, подходящие участники должны получить соответствующие инструкции.Правильный сбор образцов требует точной идентификации участников, достаточного объема образца и подходящего типа контейнера. Более того, маркировка образцов и обращение с ними должны выполняться последовательно.

Выбор по возрасту и полу

Слюна состоит из многих компонентов, включая воду, электролиты, ферменты и антимикробные агенты. Эти компоненты могут изменяться или оставаться стабильными с возрастом 19 . Например, у пожилых людей наблюдалось снижение скорости потока слюны и кальция по сравнению с молодыми людьми, тогда как уровни матриксной металлопротеиназы-8 и коллагеназы-1 значительно повышались с неизмененной альфа-амилазой слюны 19 .Однако другой предыдущий отчет показал значительное снижение активности альфа-амилазы у пожилых людей и отсутствие изменений в скорости секреции и уровне кальция в слюне 20 . Точно так же значительная разница в уровнях муцина была обнаружена во всей слюне молодых и пожилых субъектов 21 . Удивительно, но новорожденные и взрослые также продемонстрировали различия в профилях белков слюны 22 , 23 . Протеом слюны человека, такой как белки, богатые пролином, уровни пептидов, кислые фосфопротеины, богатые пролином, гистатины и цистатин S, был исследован в разных возрастных группах и обнаружил, что протеом слюны человека значительно варьируется в детском и подростковом возрасте 23 .Аналогичным образом, в предыдущем исследовании наблюдалась высокая скорость слюноотделения у здоровых добровольцев моложе 44 лет 24 . Нестимулированная секреция слюны была выше у здоровых мужчин по сравнению с женщинами, где автор предположил, что размер слюнной железы влияет на секрецию слюны, поскольку размер слюнной железы у женщин меньше, чем у мужчин 24 , 25 , что указывает на секрецию, зависящую от пола. Поэтому здоровых добровольцев из разных возрастных групп и полов следует классифицировать отдельно, чтобы ограничить статистические ошибки.

Значение положения рта во время сбора слюны

Различные пары слюнных желез включают околоушные, подчелюстные, подъязычные и многочисленные второстепенные слюнные железы. Хотя слюна, выделяемая этими железами, содержит некоторые общие компоненты, их концентрация может варьироваться от одной железы к другой 26 . Например, околоушные железы содержат большое количество серозных ацинарных клеток и вырабатывают высокие уровни альфа-амилазы и белков, богатых пролином.Хотя подчелюстные железы выделяют меньше альфа-амилазы, чем околоушные железы, они секретируют больше муцинов. Подъязычные железы в основном состоят из слизистых клеток и содержат высокие концентрации гликопротеинов (муцинов) и большое количество лизоцима. Малые слюнные железы в основном продуцируют муцины и липазу 26 .

Цельная слюна представляет собой смесь слюны, выделяемой в ротовую полость различными железами в дополнение к другим компонентам, таким как назальный и бронхиальный секрет, остатки пищи, слезы, бактерии и жидкость десневой щели 27 .Кроме того, производство слюны, ее компоненты и ее происхождение зависят от того, находится ли человек в состоянии покоя или в состоянии стимуляции. Например, стимуляция влияет на уровни кортизола, альфа-амилазы и секреторного IgA 26 . Исследователи должны учитывать, что производство и состав слюны каждой железой различны, и соответствующим образом проинструктировать людей. Каждый человек должен строго следить за литературой, касающейся методов сбора слюны.Такая последовательность в методе сбора важна, поскольку обеспечивает высокое качество данных.

Измерение объема слюны перед исследованием, представляющим интерес в исследовании плацебо: выберите только лиц, получивших промежуточную оценку

Чтобы исключить ошибки в клинических испытаниях с использованием слюны здоровых добровольцев, процедуры сбора должны быть стандартизованы. Секреция слюны варьируется у разных людей. Если один и тот же человек собирает слюну в разные моменты времени, будут получены разные скорости потока слюны, что затрудняет интерпретацию 28 .Чтобы свести к минимуму ошибку, люди, секретирующие большие объемы слюны, и люди, секретирующие малые объемы, должны быть исключены из исследования, и должны быть включены только участники с промежуточной оценкой.

Предоставьте подробную информацию о методе сбора слюны.

Для сбора цельной слюны доступны различные методы. Общие методы включают метод слива, метод сплевывания, метод всасывания и метод тампона 27 . Точно так же несколько имеющихся в продаже устройств и методов можно использовать для сбора слюны из отдельных желез 27 .Участники должны получить надлежащие инструкции о том, как лучше всего выполнить сбор проб. Настоятельно рекомендуется использовать только один тип устройства для сбора в течение данного исследования 29 . Также не рекомендуется использовать тампон или метод аспирации для сбора нестимулированной цельной слюны, поскольку действие тампона обеспечивает некоторую степень стимуляции и, таким образом, увеличивает вариабельность 27 . Предыдущее исследование показало, что биомаркеры слюны, такие как ДГЭА, тестостерон, эстрадиол и прогестерон, были статистически значимыми (p <0.005) и sIgA значительно снизился (p <0,005) в методах сбора на основе хлопка по сравнению с методами без использования хлопка, однако котинин и кортизол не пострадали, что указывает на то, что метод сбора является значительным источником несистематической ошибки 30 . Кроме того, образцы, полученные с помощью плевания, содержат больше бактерий, чем образцы, полученные с помощью слюноотделения, что может повлиять на дальнейший анализ соединений слюны 31 . Метод пассивного слюноотделения считается многообещающей альтернативой для минимизации этих потенциальных источников ошибок.Более того, с помощью метода пассивного слюноотделения можно собрать большие объемы слюны за короткое время 32 .

Хранение образцов

Если анализ должен быть выполнен немедленно, образцы можно хранить при комнатной температуре (максимум 30-90 мин) 31 . Однако в статье, опубликованной Thomadaki K et al., Предполагается, что снижение температуры инкубации снижает скорость деградации протеома слюны 33 . Таким образом, сразу после сбора слюны рекомендуется заморозить образцы при -20 ºC или ниже.Если морозильная камера недоступна, образцы можно хранить при 4 ºC, чтобы предотвратить рост бактерий и дальнейшее разложение молекул слюны (не более 6 часов) 31 . Образцы также можно хранить при -80 ºC в течение нескольких лет с незначительной деградацией или без нее. 31 , 34 . Всегда лучше всего провести аликвотирование и заморозить образцы, чтобы избежать повторяющихся циклов замораживания-оттаивания. Другие подходы к хранению и обработке образцов, включая мгновенное замораживание в жидком азоте и использование ингибиторов ферментов, описаны в предыдущих исследованиях 31 , 35 .Для анализа РНК ингибитор РНКазы следует добавить во фракции супернатанта (не в осадок) перед хранением при -80 ºC 36 . Однако недавно открытый метод QIAzol показал способность выделять высокие выходы РНК без необходимости в дополнительном стабилизаторе РНК. Используя этот метод, образцы слюны можно успешно хранить более 2 лет при -80 ºC без добавления ингибиторов РНКаз 37 .

Влияет ли психологический стресс на секрецию белка слюны?

Различные отчеты предполагают, что психологический стресс вызывает уровни альфа-амилазы и кортизола в слюне, и эти факторы стресса могут включать публичные выступления, просмотр фильмов с напряжением, стоматологические процедуры, осмотры, спортивные соревнования, приключения e.г., банджи-джампинг и т. д. 38 - 41 . Более того, уровень амилазы в слюне реагировал быстрее, чем кортизол, во время психологического стресса, что могло быть лучшим индикатором стресса 38 . Однако стресс во время стоматологического лечения показал значительные изменения в уровнях кортизола и sIgA в слюне, чем альфа-амилаза 42 . Во время острого стресса содержание нитратов и нитритов в слюне значительно увеличивается, что играет важную роль в защите желудка от стресса.Это исследование было продемонстрировано при остром стрессе, вызванном банджи-джампингом 43 . Другое интересное исследование предполагает роль стресса в секреции слюны во время спортивных соревнований, когда требуется высокая умственная активность, чтобы столкнуться с противником. В ходе исследования исследователи обнаружили, что у победителей был более высокий уровень кортизола в слюне перед соревнованиями, что указывало на психофизиологическое возбуждение, и им удавалось контролировать стресс во время соревнований, что указывало на более высокую скорость слюноотделения и более высокую секрецию sIgA 44 .Предыдущее исследование выявило значительное повышение уровня кортизола в слюне, которое наблюдалось в хронических (учеба и подготовка к экзаменам) и острых (экзамен) ситуациях учебного поведения 45 . Кроме того, на уровень кортизола в слюне и сыворотке влияют различные факторы стресса, включая бессонницу, депрессию и усталость. На усталость, вызванную бессонницей или другими факторами, могут влиять циркадные ритмы 46 . Амилаза слюны также была идентифицирована как биомаркер депривации сна у дрозофилы и человека.Уровни мРНК амилазы неуклонно повышаются во время бодрствования, несмотря на отсутствие изменений в объеме общего белка слюны 47 .

В случае предменструального синдрома (ПМС) женщины принимают психосоматические изменения, депрессию и боль в груди во время или перед менструацией 48 , 49 . Было обнаружено, что концентрация sIgA значительно повышается во время предменструальной или менструальной фазы по сравнению с постменструальной фазой. Напротив, более высокий уровень sIgA чаще наблюдался у женщин с дисменореей по сравнению с женщинами без дисменореи.Однако корреляции между ПМС и уровнем кортизола не было 49 . Во время теста социального стресса Триера (TSST) было обнаружено, что после теста уровень цистатина S, альфа-амилазы и легкой цепи IgA, глутатион-S-трансферазы и PIP (пролактин-индуцируемый белок) был выше 50 . Кроме того, уровень IL-6 в слюне был сильно повышен (приблизительно на 50%) и сохранялся в течение 20 минут у здоровых молодых людей в ответ на TSST 51 . Острый стресс активирует ось HPA и SNS, производя высокие уровни кортизола и альфа-амилазы 52 .Другой профиль состояний настроения (ПОМС) также влияет на уровень кортизола и альфа-амилазы в слюне 52 . Кроме того, исследователи также продемонстрировали вызванное стрессом повышение уровня кортизола при стратегическом поведении во время игры-конкурса красоты 53 . Было обнаружено, что при остром стрессе, вызванном публичными выступлениями, на динамические изменения, такие как концентрация кортизола, внутриротовой pH и концентрация общего белка, влияют без изменения концентрации фторида в слюне 54 .

На основании вышеупомянутых отчетов мы можем предположить, что слюнный поток и секреторные белки могут варьироваться у здоровых людей. Эти вариации могут быть связаны либо с POMS, например, депрессией, гневом, усталостью, либо с авантюризмом, либо с любым стратегическим поведением. Итак, во время сбора слюны нам необходимо подтвердить от здоровых добровольцев, что они свободны от такого психологического стресса, который напрямую влияет на объем слюны или слюнные белки. Нам необходимо разделить на разные группы или исключить таких добровольцев, чтобы ограничить статистические ошибки.Ошибки, вызванные несоблюдением требований, могут значительно ухудшить результаты постанализа.

Анкета

Каждый участник должен заполнить анкету, чтобы предоставить информацию о своем состоянии и тяжести. Более того, до того, как участник заполнит анкету 55 , необходимо записать историю определенных заболеваний, возраст и пол. Мы разделили анкету на разные разделы: социально-демографическая информация (таблица), история болезни (таблица), табачные и алкогольные привычки (таблица), гигиена полости рта (таблица) и другие (например,g., нарушение сна и речи) (таблица). Разделы показаны ниже в виде таблицы.

Таблица 1

Демографические характеристики и личная информация

до старшего
Анкета Ответ Ссылки
Пол Мужчины / Женщины / Другой возраст 55, 56 55, 56
55, 56
Вес (кг) Килограммы (кг) 56
Рост (см) 56
ИМТ (кг / м 2 ИМТ (кг / м ) Меньше / нормально / больше / ожирение 56, 57
Уровень образования 55
Страна рождения 55

903 Таблица 2

9039 Ответ Список литературы У вас системное заболевание? Да / Нет 58 Принимаете ли вы лекарства ежедневно? Да / Нет Если вы принимаете лекарства, какие лекарства / препараты вы принимаете? Типы лекарств 55, 59, 60 У женщин-добровольцев нормально ли протекают месячные? Да / Нет 61 Если у вас ненормальные месячные, когда были ваши последние месячные? дней Оцените стресс (умственный / физический) и тревогу в вашей повседневной жизни. 0-10 баллов 62 Проходили ли вы когда-нибудь лучевую терапию головы или шеи? Да / Нет Страдали ли вы когда-нибудь от заболеваний слюнных желез? Да / Нет 58 Страдали ли вы когда-нибудь артритом или каким-либо другим аутоиммунным заболеванием? Да / Нет 58 Есть ли у вас аллергия? Да / Нет У вас диабет? Да / Нет 63

Таблица 3

Табачные и алкогольные привычки

Анкета Ответ Ссылки
Вы курите? Да / Нет 55, 64
Если да, сколько сигарет вы выкуриваете в день? Сигарет в день 55
Используете ли вы табачные изделия, такие как табачные листья или табачный порошок? Да / Нет 64
Употребляете ли вы алкоголь или другие напитки (например,г., газированные напитки)? Да / Нет (укажите) 55, 65
Если да, какой объем вы потребляете в день? мл / день 55

Таблица 4

Анкета Ответ Ссылки
Есть ли у вас поражение / язвы в полости рта Да / Нет 55, 66
Вы чувствуете жжение во рту? Да / Нет 55, 57
Ощущается ли сухость во рту? Да / Нет 55, 67, 68
У вас неприятный запах изо рта? Да / Нет 55
Вы носите зубные протезы? Да / Нет 55, 57
Используете ли вы зубную пасту ежедневно? Да / Нет 55
Используете ли вы зубную нить ежедневно? Да / Нет 55
Используете ли вы жидкость для полоскания рта ежедневно? Да / Нет 55

Таблица 5

Анкета Ответ Ссылки
Ощущается ли сухость во рту во время еды? Да / Нет 60, 67
Испытываете ли вы трудности с проглатыванием сухого корма? Да / Нет 67, 69
Кажется, у вас слишком мало слюны во рту? Да / Нет 60, 67
Часто ли вы пьете воду или сок? Да / Нет
Если да, какой объем вы потребляете в день? мл / день
Испытываете ли вы трудности при разговоре? Да / Нет 69
Есть ли у вас проблемы со сном из-за сухости? Да / Нет 65, 69
Вы сосете сладкое или жуете жвачку, чтобы уменьшить сухость во рту? Да / Нет 65, 70
Ваша кожа лица кажется сухой? Да / Нет 65, 70
Ваши глаза кажутся сухими? Да / Нет 68, 70
Ваши губы сухие? Да / Нет 65, 70
Ощущается ли сухость во внутренней части носа? Да / Нет 70
Ощущается ли сухость в горле? Да / Нет 63, 71

На каждый вопрос следует ответить «да» или «нет».Если человек отвечает «да», следует записать частоту и тяжесть состояния. Если человек испытывает ксеростомию, ответ следует записать по 10-балльной шкале (от 0 = не сухо до 10 = очень сухо).

Критерии включения

Участников следует отбирать на основе следующих критериев.

  • Участники должны быть в возрасте 18 лет и старше. Примечание. Лица моложе 18 лет могут не понимать анкету, могут не понимать форму согласия, неправильно заполнять форму согласия или не следовать инструкциям.Более того, люди в возрасте 60 лет и старше не должны участвовать в исследовании. Хотя в остальном эти люди могут быть здоровыми, частота гипосаливации у пожилых людей выше, чем у молодых людей 60 .

  • Участники должны уметь читать, заполнять и подписывать форму согласия.

  • Участники должны понять анкету и ответить на нее.

  • Добровольцы должны быть здоровы, особенно в отношении слюнных желез и слизистой оболочки полости рта 68 .

  • У участников не должно быть сухости во рту или сухости глаз.

Критерии исключения

  • Участники младше 18 лет.

  • Участники, которые не могут прочитать или понять форму согласия.

  • Лица, ответившие «да» на вопрос, связанный с сухостью. Эти люди считаются положительными на ксеростомию и не могут участвовать в исследовании.

  • Беременные.

  • Участники, жалующиеся на сухость во рту или сухость глаз 68 .

  • Пациенты с поражениями полости рта или другой контактной чувствительностью 66 .

  • Пациенты, страдающие аутоиммунными заболеваниями, такими как синдром Шегрена, ревматоидный артрит, системная красная волчанка или прогрессирующий системный склероз, поскольку у лиц с этими аутоиммунными воспалительными заболеваниями наблюдается стойкая ксеростомия 58 , 72.

  • Лица, остро или хронически употребляющие лекарства, вызывающие сухость во рту 66 . К ним относятся такие препараты, как антигистаминные, антипсихотические и антидепрессанты 58 , 59 .

  • Пациенты, проходящие лучевую терапию (в основном для лечения рака головы и шеи).

  • Лица с хроническим заболеванием, если оно не контролируется должным образом.

  • Лица, инфицированные ВИЧ, гепатитом B или C.

Ошибка отбора и управление пробой

Вероятность ошибки при отборе проб наиболее высока во время сбора и обработки слюны. Неправильные методы сбора слюны также приводят к ошибке отбора пробы 73 . Исследователь должен использовать ответы на вопросы анкеты, чтобы выбрать подходящих добровольцев. Лучше выбрать популяцию с промежуточной оценкой, чтобы минимизировать возможные вариации скорости слюноотделения. Во время сбора слюны следует ограничить употребление еды и напитков.Однако в некоторых случаях пищу можно съесть за 30 минут 32 за 1 час до того, как плюнуть 9 . Пациенту следует прополоскать рот деионизированной водой и подождать не менее 10 минут, прежде чем предоставить образец 32 . Четкая и понятная маркировка необходима для правильной идентификации образцов и обращения с ними. Для длительного хранения настоятельно рекомендуется использовать перманентные маркеры или этикетки со штрих-кодом. 34 .

Оптимальная методика отбора проб перед взятием (как указано в разделах 3.3 и 3.5) следует тщательно выбирать в зависимости от возраста и интересующего эксперимента. Участники должны быть проинструктированы об оптимальном размещении и сроке действия устройства или тампона, чтобы обеспечить точность измерения аналитов. Собранная слюна не должна содержать твердых частиц или других мешающих веществ 32 . Загрязнение образца можно предотвратить, надев перчатки и используя чистые материалы для сбора 74 . После сбора образец следует хранить или обрабатывать соответствующим образом, как описано в разделе 3.6. Некоторые аналиты слюны, такие как дегидроэпиандростерон, эстрадиол и прогестерон, очень чувствительны к замораживанию-оттаиванию, поэтому следует избегать многократных циклов замораживания-оттаивания 32 .

К другим влияющим факторам относятся возраст, половая принадлежность и среда проживания. Было показано, что продолжительность и временной интервал сбора образцов влияет на концентрацию аналитов, в основном на маркеры стресса, такие как кортизол, секреторный иммуноглобулин A и хромогранин A 74 . Сбор слюны у здоровых добровольцев подобен наблюдательному исследованию, в котором участников следует выбирать на основе ответов на анкету, подробных историй болезни и полных клинических обследований, если применимо.Различные аспекты соблюдения режима сбора слюны у здоровых добровольцев могут минимизировать ошибку отбора проб. Эти аспекты кратко представлены на рисунке.

Четыре этапа сбора слюны у здоровых добровольцев

Чтобы преодолеть колебания от образца к образцу, необходимо измерить выход слюны у каждого человека. В частности, каждого человека следует классифицировать как выделяющего высокий, средний или низкий объем слюны. Скорость слюноотделения у здоровых людей различается 75 .Это изменение напрямую влияет на общую концентрацию и ферментативную активность белков, таких как альфа-амилаза слюны, у здоровых молодых людей, даже в отсутствие стрессового стимула 4 . Скорость потока слюны, общая концентрация белка в слюне и осмоляльность слюны являются потенциальными маркерами состояния гидратации всего тела и могут колебаться во время острого обезвоживания 76 . Коэффициенты нормализации (например, концентрация креатинина в образцах мочи) 77 для образцов слюны еще не установлены; однако измерение концентрации общего белка постоянно используется для нормализации концентрации аналитов в слюне, поскольку различные стимуляции могут влиять на концентрацию общего белка в слюне 78 , 79 .Согласно предыдущему исследованию, увеличение скорости потока слюны фактически уменьшило общую концентрацию белка в образцах слюны 78 . Однако в одном исследовании авторы обнаружили, что концентрация белка в образцах слюны не была сильно связана с объемом слюны, но была связана с концентрацией СРБ в слюне. Считается, что это открытие важно для популяции новорожденных, у которой объем слюны сильно колеблется 80 .

Циркадные и суточные ритмы также влияют на нестимулированный расход слюны 81 , 82 , в дополнение к концентрациям натрия и калия 81 .Следовательно, чтобы гарантировать получение стабильных результатов, людей следует отбирать на основе скорости их слюноотделения (а не объема слюны). В исследование следует включать только тех, у кого секреция слюны находится в среднем диапазоне. Более того, время сбора исходного образца должно быть установлено примерно в одно и то же время каждый день для всех людей, чтобы минимизировать вариабельность 82 .

Другой метод уменьшения вариабельности выборки - это попытка собрать образцы в несколько дней.Участников следует попросить собирать образцы в разные дни (например, в течение 5 дней) в указанное время и при определенных условиях (как указано в разделе 2). Образцы можно собирать дома или в центре сбора. Собираются все образцы и исследуются основные биомаркеры, такие как скорость слюноотделения, концентрация общего белка и ферменты слюны (например, альфа-амилаза). Этот метод помогает определить, в какой степени участники соблюдали соответствующие руководящие принципы 83 .Участники с хорошим соблюдением протокола и с минимальным количеством ошибок или без них в течение многодневного периода сбора данных будут выбраны для дальнейших клинических испытаний как здоровые добровольцы (рисунок). Для любого типа испытания лекарственного средства необходимо сравнивать результаты пациентов с болезнью и здоровых людей; этот шаг включен в следующую фазу клинического испытания.

Процесс сбора образцов (слюны) для минимизации индивидуальной вариабельности

Обсуждение и выводы

Мы разработали стратегический протокол сбора слюны у здоровых добровольцев.В различных исследованиях изучалась эффективность вмешательств для лечения ксеростомии и других осложнений, связанных с сухостью. В клинических испытаниях проводится статистический анализ для сравнения результатов здоровых участников с результатами пациентов. Правильный сбор слюны у здоровых добровольцев необходим для минимизации ошибки отбора проб. Оптимизированный протокол для оценки образцов слюны здоровых людей еще не разработан, и Национальные институты здравоохранения все еще набирают здоровых добровольцев для оценки слюны 84 .Более того, многие исследования здоровых добровольцев не включали подробные анкеты, что увеличивает ошибку выборки. Более того, неадекватные анкеты могут не получить достаточной информации для отбора подходящих лиц. Мы стремились собрать эту информацию, добавив анкету, которая помогает определить, удовлетворяют ли здоровые добровольцы критериям включения или исключения. Эти вопросы могут снизить риск неточного измерения аналитов слюны у здоровых людей (Таблицы -).

Загрязнение слюны кровью или другими веществами может помешать иммуноанализу после сбора. Участники исследования, сдающие слюну, должны знать несколько факторов. Во-первых, употребление алкоголя менее чем за 12 часов до сбора слюны может повлиять на состав слюны. Точно так же потребление пищи, содержащей продукты с высоким содержанием сахара, высокой кислотности и / или кофеина, может снизить pH слюны и, таким образом, увеличить рост бактерий. Добровольцев также следует проверять на предмет гигиены полости рта, травм полости рта и привычки чистить зубы.Кроме того, необходимо документально подтвердить использование лекарств и никотина 85 .

Еще одним фактором, ответственным за ошибку выборки, является устройство для сбора. Как описано в разделе 2, было разработано несколько методов и устройств для сбора слюны. Вдобавок недавно был разработан Muddler 86 . Это устройство может использоваться как с младенцами, так и со взрослыми и может эффективно собирать постоянный объем слюны. Кроме того, это устройство очень полезно для исследований, связанных со стрессом и иммунитетом, а также для других анализов биомаркеров слюны 86 .Однако особое внимание следует уделить хранению образцов перед анализом 87 .

При правильном обращении со слюной биомаркеры слюны, такие как ферменты и белки (например, альфа-амилаза) 4 , стрессовые белки (например, GRP78) 3 , 88 и HSP70 89 , инфекционные заболевания (например, ВИЧ), плоскоклеточный рак полости рта 90 , 91 и маркеры неоплазии CA125 92 могут быть эффективно оценены.Кроме того, могут быть использованы аналиты, такие как гормоны, стероиды, антитела, факторы роста, цитокины, хемокины, нуклеиновые кислоты и белки, связанные с различными системными заболеваниями, психологическими исследованиями, аутоиммунными заболеваниями и заболеваниями полости рта (вызванными грибками, вирусами и бактериями). успешно реализовано в диагностических приложениях 87 .

Благодарности

Работа выполнена при поддержке Программы совместных исследований для развития сельскохозяйственных наук и технологий (проект №PJ01158104 и PJ01389701), финансируемая Администрацией сельского развития Республики Корея. Это исследование также было поддержано Программой развития био- и медицинских технологий (NRF-2017M3A9E4047243), финансируемой Министерством науки, ИКТ и планирования будущего Республики Корея.

Аббревиатуры

910C карцином
CRP C-реактивный белок
Ig Иммуноглобулин
sIgA Секреторный иммуноглобулин A Сквотный клеточный иммуноглобулин A
A Синдром необходимого иммунодефицита
CD Кластер дифференцировки
HPA Гипоталамо-гипофизарно-надпочечниковый
SNS SNS Симпатическая нервная система связывающий белок
MRP14 Миелоид-родственный белок 14
NF-kB Ядерный фактор-каппа B
IL Интерлейкин
Жидкостная хроматография 90-407 ВЭЖХ
ELISA Ферментно-связанный иммуноферментный анализ
ЖХ / МС Жидкостная хроматография-масс-спектрометрия
MALDI-TOF MS Матричная лазерная десорбция / время ионизации-времяпролетного масс-спектрометра PC7 Полимеразная цепная реакция
GRP78 Глюкозо-регулируемый белок 78
HSP70 Белок теплового шока 70.

Ссылки

1. Джавид М.А., Ахмед А.С., Дюран Р., Тран С.Д. Слюна как средство диагностики заболеваний полости рта и системных заболеваний. Журнал биологии полости рта и черепно-лицевых исследований. 2016; 6: 66–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 2. Бхаттарай К.Р., Ли С.В., Ким С.Х., Ким Х.Р., Чае Х.Дж. Экстракт Ixeris dentata регулирует секрецию слюны за счет активации аквапорина-5 и предотвращает ксеростомию, вызванную диабетом. Журнал экспериментальной фармакологии. 2017; 9: 81–91. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3.Бхаттарай К.Р., Ли Х.Й., Ким С.Х., Ким Х.Р., Чае Х.Дж. Экстракт Ixeris dentata увеличивает секрецию слюны за счет регуляции стресса эндоплазматической сети на модели крыс с ксеростомией, вызванной диабетом. Международный журнал молекулярных наук. 2018; 19 (4): 1059. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Архакис А., Карагианнис В., Калфас С. Активность альфа-амилазы в слюне и скорость слюноотделения у молодых людей. Журнал открытой стоматологии. 2013; 7: 7–15. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5.Лукач-младший, Ларгаэспада LL. Объяснение половых различий в распространенности кариеса зубов: слюна, гормоны и этиология "анамнеза". Американский журнал биологии человека: официальный журнал Совета по биологии человека. 2006; 18: 540–55. [PubMed] [Google Scholar] 6. Дауэс К. Влияние диеты на секрецию и состав слюны. Журнал стоматологических исследований. 1970; 49: 1263–73. [PubMed] [Google Scholar] 7. Сундус Исмаил Аль-Аззави, Алия Махмуд Альван, Салал Р.Х. Влияние возраста и пола на скорость слюноотделения у пациентов с полной адентией.MDJ. 2013; 10: 64–8. [Google Scholar] 8. Мохамед Р., Кэмпбелл Дж. Л., Купер-Уайт Дж., Димески Дж., Пуньядира С. Влияние методов сбора и обработки слюны на иммуноанализы CRP, IgE и миоглобина. Клиническая и трансляционная медицина. 2012; 1:19. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Белцер Е.К., Фортунато СК, Гуадеррама М.М., Пекинс М.К., Гаррамоне Б.М., Грейнджер Д.А. Слюноотделение и альфа-амилаза: метод сбора, продолжительность и тип ротовой жидкости. Физиология и поведение. 2010; 101: 289–96.[PubMed] [Google Scholar] 10. Jenzano JW, Hogan SL, Lundblad RL. Факторы, влияющие на измерение лизоцима слюны человека в лизопластинчатых и турбидиметрических анализах. Журнал клинической микробиологии. 1986; 24: 963–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Castagnola M, Scarano E, Passali GC, Messana I, Cabras T., Iavarone F. et al. Биомаркеры слюны и протеомика: будущие диагностические и клинические возможности. Acta otorhinolaryngologica Italica: Organo ufficiale della Societa italiana di otorinolaringologia e chirurgia cervico-facciale.2017; 37: 94–101. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12. Аль Кавас С., Рахим Ж., Фергюсон Д.Б. Возможное использование анализа белков слюны человека и пептидов в диагностике заболеваний. Архив устной биологии. 2012; 57: 1–9. [PubMed] [Google Scholar] 13. Саннам Хан Р., Хуршид З., Ахбар С., Фараз Мойн С. Достижения протеомики слюны при обнаружении плоскоклеточной карциномы полости рта (OSCC): обновление. Протеомы. 2016; 4 (4): 41. [Бесплатная статья PMC] [PubMed] [Google Scholar] 14. Ху С., Арельяно М., Бунхын П., Ван Дж., Чжоу Х., Цзян Дж.и другие. Протеомика слюны для открытия биомаркеров рака полости рта. Клинические исследования рака: официальный журнал Американской ассоциации исследований рака. 2008; 14: 6246–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Родус Н.Л., Хо В., Миллер С.С., Майерс С., Ондри Ф. Уровни цитокинов, зависимых от NF-kappaB, в слюне пациентов с пренеопластическими поражениями полости рта и плоскоклеточным раком полости рта. Обнаружение и профилактика рака. 2005; 29: 42–5. [PubMed] [Google Scholar] 16. Азиз С., Ахмед С.С., Али А., Хан Ф.А., Зульфикар Г., Икбал Дж.и другие. Иммуносупрессивные цитокины IL-10 и IL-13 слюны значительно повышены у пациентов с плоскоклеточной карциномой полости рта. Расследование рака. 2015; 33: 318–28. [PubMed] [Google Scholar] 17. Рю ОХ, Аткинсон Дж.С., Хоэн Г.Т., Иллей Г.Г., Харт ТС. Идентификация биомаркеров околоушной слюны при синдроме Шегрена с помощью поверхностно-усиленной лазерной десорбции / ионизации времяпролетной масс-спектрометрии и двумерного разностного гель-электрофореза. Ревматология. 2006; 45: 1077–86. [PubMed] [Google Scholar] 18.Полынь К.Л., Аслебаг Р., Чаннавираппа Д., Дюпри Э.Дж., Борланд М.М., Райан Дж. П. и другие. Протеомика и биомаркеры слюны в неврологии и психиатрии. Протеомика Клинические приложения. 2015; 9: 899–906. [PubMed] [Google Scholar] 19. Нассар М., Хираиши Н., Ислам М.С., Оцуки М., Тагами Дж. Возрастные изменения биомаркеров слюны. Журнал стоматологических наук. 2014; 9: 85–90. [Google Scholar] 20. Бен-Арье Х., Шалев А., Саргель Р., Лаор А., Лауфер Д., Гутман Д. Скорость слюны и состав цельной и околоушной слюны в покое и стимулированной слюны у молодых и старых здоровых субъектов.Биохимическая медицина и метаболическая биология. 1986; 36: 260–5. [PubMed] [Google Scholar] 21. Denny PC, Denny PA, Klauser DK, Hong SH, Navazesh M, Tabak LA. Возрастные изменения муцинов цельной слюны человека. Журнал стоматологических исследований. 1991; 70: 1320–7. [PubMed] [Google Scholar] 22. Inzitari R, Vento G, Capoluongo E, Boccacci S, Fanali C, Cabras T. et al. Протеомный анализ кислых белков с высоким содержанием пролина в слюне у недоношенных и доношенных новорожденных. Журнал протеомных исследований. 2007; 6: 1371–7. [PubMed] [Google Scholar] 23.Кабрас Т., Пизано Э., Бой Р., Олианас А., Манкони Б., Инзитари Р. и др. Возрастные модификации секреторного белкового комплекса слюны человека. Журнал протеомных исследований. 2009. 8: 4126–34. [PubMed] [Google Scholar] 24. Фенолл-Паломарес С., Муньос Монтагуд СП, Санчиз В., Эррерос Б., Эрнандес В., Мингес М. и др. Нестимулированный расход слюны, pH и буферная способность слюны у здоровых добровольцев. Revista espanola de enfermedades digestivas: официальный орган общества испанской патологии.2004. 96: 773–83. [PubMed] [Google Scholar] 25. Скотт Дж. Возраст, пол и контралатеральные различия в объемах подчелюстных слюнных желез человека. Архив устной биологии. 1975. 20: 885–7. [PubMed] [Google Scholar]

26. Салиметрия. Важность расположения рта во время сбора слюны. 1-7.

27. Навазеш М. Методы сбора слюны. Летопись Нью-Йоркской академии наук. 1993; 694: 72–7. [PubMed] [Google Scholar]

28. Рантонен П. Слюноотделение и состав у здоровых и больных взрослых.2003.

29. Голатовски С., Салазар М.Г., Допл В.М., Хаммер Э., Кочер Т., Джемлих Н. и др. Сравнительная оценка методов сбора слюны для протеомного анализа. Clinica chimica acta; международный журнал клинической химии. 2013; 419: 42–6. [PubMed] [Google Scholar] 30. Руберклифф Э.А., Грейнджер Д.А., Шварц Э., Карран М.Дж. Использование биомаркеров слюны в биоповеденческих исследованиях: методы сбора образцов на основе хлопка могут повлиять на результаты иммуноанализа слюны. Психонейроэндокринология. 2001; 26: 165–73.[PubMed] [Google Scholar] 31. Чиаппин С., Антонелли Г., Гатти Р., Де Пало Э. Ф. Образец слюны: новый лабораторный инструмент для диагностики и фундаментальных исследований. Clinica chimica acta; международный журнал клинической химии. 2007; 383: 30–40. [PubMed] [Google Scholar] 32. Грейнджер Д.А., Джонсон С.Б., Сантон С.Л., Аут Д., Шуман Л.Л. Включение биомаркеров слюны в исследования медсестер: обзор и обзор передовой практики. Биологические исследования для медсестер. 2012; 14: 347–56. [Бесплатная статья PMC] [PubMed] [Google Scholar] 33.Томадаки К., Хелмерхорст Э.Д., Тиан Н., Сан X, Сикейра В.Л., Уолт Д.Р. и другие. Протеолиз цельной слюны и его влияние на диагностику слюны. Журнал стоматологических исследований. 2011; 90: 1325–30. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Salimetrics L, SalivaBio L. Советы по отбору слюны и обращению с ней. Салиметрия. 2015; 3 (3-е издание): 1–15. [Google Scholar] 35. Нуркка А., Обиеро Дж., Кайхти Х., Скотт Дж. А. Влияние методов сбора и хранения образцов на антипневмококковый иммуноглобулин А в слюне. Клинико-диагностическая лабораторная иммунология.2003. 10: 357–61. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Хенсон Б.С., Вонг Д.Т. Сбор, хранение и обработка образцов слюны для последующих молекулярных приложений. Методы молекулярной биологии. 2010; 666: 21–30. [PubMed] [Google Scholar] 37. Pandit P, Cooper-White J, Punyadeera C. Метод экстракции РНК с высоким выходом из слюны. Клиническая химия. 2013; 59: 1118–22. [PubMed] [Google Scholar] 38. Такай Н., Ямагути М., Арагаки Т., Это К., Учихаши К., Нисикава Ю. Влияние психологического стресса на уровни кортизола и амилазы в слюне у здоровых молодых людей.Архив устной биологии. 2004; 49: 963–8. [PubMed] [Google Scholar] 39. Нейтек В.А. События с высоким и низким уровнем эмоций влияют на восприятие эмоционального стресса и связаны с изменениями реакции кортизола в слюне в последовательной парадигме стресса. Психонейроэндокринология. 2002; 27: 337–52. [PubMed] [Google Scholar] 40. Хенниг Дж., Лашефски У., Оппер С. Биопсихологические изменения после банджи-джампинга: иммунореактивность бета-эндорфина как медиатор эйфории? Нейропсихобиология. 1994; 29: 28–32. [PubMed] [Google Scholar] 41.ван ден Бос Э, де Рой М, Мерс АС, Бохорст ЦЛ, Вестенберг ПМ. Повышение стрессовой реакции подростков на социальную оценку: влияние пубертата на кортизол и альфа-амилазу во время публичных выступлений. Развитие ребенка. 2014; 85: 220–36. [PubMed] [Google Scholar] 42. Охура К., Нодзаки Т., Шинохара М., Дайто К., Сономото М., Дайто М. Полезность биомаркера слюны для стресса, вызванного стоматологическим лечением. Обзор японской стоматологии. 2012; 48: 14–7. [Google Scholar] 43. Цзинь Л., Цинь Л., Ся Д, Лю Х, Фань З, Чжан К.и другие. Активная секреция и защитный эффект нитрата слюны от стресса у людей-добровольцев и крыс. Свободнорадикальная биология и медицина. 2013; 57: 61–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 44. Папакоста Э., Насис Г.П., Глисон М. Гормоны слюны и беспокойство у победителей и проигравших международных соревнований по дзюдо. Журнал спортивных наук. 2016; 34: 1281–7. [PubMed] [Google Scholar] 45. Гонсалес-Кабрера Дж., Фернандес-Прада М, Ирибар-Ибабе С., Пейнадо Дж. М.. Острый и хронический стресс увеличивает уровень кортизола в слюне: исследование в реальных условиях национального экзамена, проведенного выпускниками медицинских вузов.Стресс. 2014; 17: 149–56. [PubMed] [Google Scholar] 46. Майкл DJ, Валле Б., Кокс Дж., Калнс Дж. Э., Фогт Д.Л. Слюнные биомаркеры физической усталости как маркеры депривации сна. Журнал клинической медицины сна: JCSM: официальное издание Американской академии медицины сна. 2013; 9: 1325–31. [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Сёгнет Л., Боеро Дж., Готтшалк Л., Дантли С.П., Шоу П.Дж. Идентификация биомаркера влечения ко сну у мух и людей. Труды Национальной академии наук Соединенных Штатов Америки.2006; 103: 19913–8. [Бесплатная статья PMC] [PubMed] [Google Scholar] 48. Кранер-младший, Сигмон С.Т., Мартинсон А.А., МакГилликадди М.Л. Предменструальные расстройства и размышления. Журнал клинической психологии. 2014; 70: 32–47. [PubMed] [Google Scholar] 49. Ватанабе К., Сиракава Т. Характеристики воспринимаемого стресса и уровней секреторного иммуноглобулина А и кортизола в слюне у японских женщин с предменструальным синдромом. Обучение сестринскому и акушерскому делу. 2015; 4: e24795. [Бесплатная статья PMC] [PubMed] [Google Scholar] 50. Труба А.Ф., Мизрахи Д., Аучус Р.Дж., Фогель П.Д., Ритц Т.Влияние психосоциального стресса на характер высвобождения белка слюной. Физиология и поведение. 2012; 105: 841–9. [PubMed] [Google Scholar] 51. Идзава С., Сугая Н., Кимура К., Огава Н., Ямада К.С., Широтсуки К. и др. Повышение уровня интерлейкина-6 в слюне после острого психосоциального стресса и его биологические корреляты у здоровых молодых людей. Биологическая психология. 2013; 94: 249–54. [PubMed] [Google Scholar] 52. Джайлз Г.Е., Махони С.Р., Бруни Т.Т., Тейлор Х.А., Канарек РБ. Влияние стресса на настроение, ось HPA и вегетативную реакцию: сравнение трех парадигм психосоциального стресса.ПлоС один. 2014; 9: e113618. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53. Ледер Дж., Хауссер Дж. А., Мойзиш А. Стресс и принятие стратегических решений в игре конкурса красоты. Психонейроэндокринология. 2013; 38: 1503–11. [PubMed] [Google Scholar] 54. Наумова Е.А., Сандулеску Т., Бохниг С., Аль-Хатиб П., Ли В.К., Циммер С. и др. Динамические изменения слюны после острого психического стресса. Научные отчеты. 2014; 4: 4884. [Бесплатная статья PMC] [PubMed] [Google Scholar] 55. Вилла А, Абати С. Факторы риска и симптомы, связанные с ксеростомией: перекрестное исследование.Австралийский стоматологический журнал. 2011; 56: 290–5. [PubMed] [Google Scholar] 56. Sawair FA, Ryalat S, Shayyab M, Saku T. Нестимулированная скорость слюноотделения у здорового взрослого населения Иордании. Журнал исследований клинической медицины. 2009; 1: 219–25. [Бесплатная статья PMC] [PubMed] [Google Scholar] 57. Villa A, Polimeni A, Strohmenger L, Cicciu D, Gherlone E, Abati S. Собственные отчеты стоматологических пациентов о ксеростомии и связанных с ней факторах риска. Журнал Американской стоматологической ассоциации. 2011; 142: 811–6. [PubMed] [Google Scholar] 58.Мортазави Х., Бахарванд М., Мовахедиан А., Мохаммади М., Ходадустан А. Ксеростомия, вызванная системным заболеванием: обзор 20 состояний и механизмов. Летопись медицинских и медицинских исследований. 2014; 4: 503–10. [Бесплатная статья PMC] [PubMed] [Google Scholar] 59. Дэниэлс TE. Оценка, дифференциальная диагностика и лечение ксеростомии. Журнал ревматологии Дополнение. 2000; 61: 6–10. [PubMed] [Google Scholar] 60. Гупта А., Эпштейн Дж. Б., Срусси Х. Гипосаливация у пожилых пациентов. Журнал. 2006; 72: 841–6.[PubMed] [Google Scholar] 61. Салуджа П., Шетти В., Дэйв А., Арора М., Ханс В., Мадан А. Сравнительная оценка влияния менструации, беременности и менопаузы на скорость слюноотделения, pH и вкусовую функцию. Журнал клинико-диагностических исследований: JCDR. 2014; 8: ZC81–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Вирабхадраппа С.К., Чандраппа ПР, Патил С., Рудмал С.Ю., Кумарсвами А., Чаппи М.К. Оценка ксеростомии при различных психологических расстройствах: обсервационное исследование. Журнал клинико-диагностических исследований: JCDR.2016; 10: ZC24 – ZC7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 63. Сребный Л.М., Валдини А.Ю., Ксеростомия Ю.А. Часть II: Связь с неоральными симптомами, лекарствами и заболеваниями. Хирургия полости рта, стоматология и патология полости рта. 1989. 68: 419–27. [PubMed] [Google Scholar] 64. Rad M, Kakoie S, Niliye Brojeni F, Pourdamghan N. Влияние длительного курения на скорость слюноотделения и здоровье полости рта. Журнал стоматологических исследований, стоматологических клиник, стоматологических перспектив. 2010; 4: 110–4. [Бесплатная статья PMC] [PubMed] [Google Scholar] 65.Томсон WM, Чалмерс JM, Спенсер AJ, Slade GD. Лекарства и сухость во рту: результаты когортного исследования пожилых людей. Журнал государственной стоматологии. 2000; 60: 12–20. [PubMed] [Google Scholar] 66. Пун Р., Су Н, Чинг В., Дарлинг М., Грушка М. Снижение нестимулированной скорости слюноотделения при синдроме жжения во рту. Британский стоматологический журнал. 2014; 217: Е14. [PubMed] [Google Scholar] 67. Фарси НМ. Признаки сухости во рту в зависимости от скорости потока слюны, pH, буферной способности и жалоб на сухость во рту. BMC здоровье полости рта.2007; 7:15. [Бесплатная статья PMC] [PubMed] [Google Scholar] 68. Фенол-Паломарес С., Муньос-Монтагуд Дж., Санчиз В., Эррерос Б., Эрнандес В., Мингес М. и др. Нестимулированный расход слюны, pH и буферная способность слюны у здоровых добровольцев. Revista espanola de enfermedades digestivas. 2004. 96: 773–83. [PubMed] [Google Scholar] 69. Аладжбег И., Фалькао Д.П., Тран С.Д., Мартин-Гранизо Р., Лафори Г.И., Матранга Д. и др. Интраоральный электростимулятор для снятия ксеростомии: долгосрочное, многоцентровое, открытое, неконтролируемое, клиническое испытание.Хирургия полости рта, стоматология, патология полости рта и радиология полости рта. 2012; 113: 773–81. [PubMed] [Google Scholar] 70. van der Putten GJ, Brand HS, Schols JM, de Baat C. Диагностическая пригодность опросника по ксеростомии и связь между ксеростомией, гипосаливацией и использованием лекарств в группе жителей дома престарелых. Клинические оральные исследования. 2011; 15: 185–92. [Бесплатная статья PMC] [PubMed] [Google Scholar] 71. Корабль JA. Диагностика, лечение и профилактика заболеваний слюнных желез. Заболевания полости рта.2002; 8: 77–89. [PubMed] [Google Scholar] 72. Бхаттарай К.Р., Джунджаппа Р., Хандигунд М., Ким Г.-Р., Чае Х.-Дж. Отпечаток слюнной секреции при аутоиммунных нарушениях и связанных с ними патологических состояниях. Обзоры аутоиммунитета. 2018; 17: 376–390. [PubMed] [Google Scholar] 73. Эразмус К.Э., Ван Хюльст К., Ван Ден Хуген Ф.Дж., Ван Лимбек Дж., Ролевельд Н., Вирман Е.К. и другие. Загустение слюны после эффективного управления слюнотечением с помощью ботулинического токсина A. Медицина развития и детская неврология. 2010; 52: e114–8. [PubMed] [Google Scholar] 74.Lensen CM, Moons CP, Diederich C. Отбор проб слюны у собак: как выбрать наиболее подходящую процедуру для вашего исследования. Журнал ветеринарного поведения: клиническое применение и исследования. 2015; 10: 504–12. [Google Scholar] 75. Ghezzi EM, Lange LA, Ship JA. Определение вариации стимулированного слюноотделения. Журнал стоматологических исследований. 2000; 79: 1874–8. [PubMed] [Google Scholar] 76. Уолш Н. П., Монтегю Дж. С., Каллоу Н., Роулендс А. В.. Скорость потока слюны, концентрация общего белка и осмоляльность как потенциальные маркеры состояния гидратации всего тела во время прогрессирующего острого обезвоживания у людей.Архив устной биологии. 2004. 49: 149–54. [PubMed] [Google Scholar] 77. Вагнер Б.Д., Accurso FJ, Лагуна Т.А. Применимость креатинина мочи в качестве метода нормализации образцов у пациентов с муковисцидозом. Журнал муковисцидоза: официальный журнал Европейского общества муковисцидоза. 2010; 9: 212–6. [Бесплатная статья PMC] [PubMed] [Google Scholar] 78. Goodson JM, Kantarci A, Hartman ML, Denis GV, Stephens D, Hasturk H. et al. Риск метаболических заболеваний у детей по анализу биомаркеров слюны.ПлоС один. 2014; 9: e98799. [Бесплатная статья PMC] [PubMed] [Google Scholar] 79. Ли Дж.Й., Чанг Дж.В., Ким Ю.К., Чунг С.К., Хо Х.С. Сравнение состава остаточной слюны слизистой оболочки полости рта и цельной слюны. Заболевания полости рта. 2007; 13: 550–4. [PubMed] [Google Scholar] 80. Айенгар А., Паулюс Дж. К., Герлан Диджей, Марон Дж. Л.. Обнаружение и потенциальная полезность C-реактивного белка в слюне новорожденных. Границы педиатрии. 2014; 2: 131. [Бесплатная статья PMC] [PubMed] [Google Scholar] 81. Дауэс С. Циркадные ритмы скорости потока и состава нестимулированной и стимулированной подчелюстной слюны человека.Журнал физиологии. 1975. 244: 535–48. [Бесплатная статья PMC] [PubMed] [Google Scholar] 82. Свенсон Л.И. Прогресс в исследовании онкомаркеров. 2007; 2007. С. 17–41. [Google Scholar] 83. Халперн Т. Т., Уитсел Е. А., Вагнер Б., Харрис К. М.. Проблемы измерения суточной концентрации кортизола в крупном популяционном полевом исследовании. Психонейроэндокринология. 2012; 37: 499–508. [Бесплатная статья PMC] [PubMed] [Google Scholar]

84. ClinicalTrials.gov. Оценка слюны у здоровых добровольцев. 2017.

85.Salimetrics L. Сбор и обработка слюны. 2011; 2 (2-е издание): 1-11.

86. Такаги К., Исикура Ю., Хирамацу М., Накамура К., Дегава М. Разработка устройства для сбора слюны для использования в полевых условиях. Clinica chimica acta; международный журнал клинической химии. 2013; 425: 181–5. [PubMed] [Google Scholar] 88. Джусти Л., Бальдини С., Сирегия Ф., Джанначчини Дж., Джакомелли С., Де Фео Ф. и др. Является ли GRP78 / BiP потенциальным биомаркером слюны у пациентов с ревматоидным артритом? Протеомика Клинические приложения.2010; 4: 315–24. [PubMed] [Google Scholar] 89. Fabian TK, Fejerdy P, Nguyen MT, Soti C, Csermely P. Потенциальные иммунологические функции Hsp70 слюны в защитных механизмах слизистой оболочки и пародонта. Archivummunologiae et therapiae experimentalis. 2007; 55: 91–8. [PubMed] [Google Scholar] 90. Шерман Г.Г., Лилиан Р.Р., Кувадия А.Х. Тесты ротовой жидкости для скрининга младенцев, подвергшихся воздействию вируса иммунодефицита человека. Журнал детских инфекционных болезней. 2010; 29: 169–72. [PubMed] [Google Scholar] 92. Ага-Хоссейни Ф, Мирзайи-Дизга I, Рахими А., Сейланян-Туси М.Корреляция уровней CA125 в сыворотке и слюне у пациентов с раком груди. Журнал современной стоматологической практики. 2009; 10: E001–8. [PubMed] [Google Scholar]

стратегий управления рисками и ошибками

Int J Med Sci. 2018; 15 (8): 823–831.

Каши Радж Бхаттараи

1 Кафедра фармакологии и Институт разработки новых лекарств, Школа медицины, Национальный университет Чонбук, Чонджу, Республика Корея;

Хён-Рён Ким

2 Высшая школа, Институт науки и технологий Тэгу Кёнбук (DGIST), Тэгу, 42988, Республика Корея.

Хан-Чжун Ча

1 Кафедра фармакологии и Институт разработки новых лекарств, Школа медицины, Национальный университет Чонбук, Чонджу, Республика Корея;

1 Кафедра фармакологии и Институт разработки новых лекарств, Школа медицины, Национальный университет Чонбук, Чонджу, Республика Корея;

2 Высшая школа, Институт науки и технологий Тэгу Кёнбук (DGIST), Тэгу, 42988, Республика Корея.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Поступило 25.01.2018 г .; Принято 14 апреля 2018 г.

Авторские права © Ivyspring International Publisher Эта статья цитируется в других статьях в PMC.

Abstract

Технологии биологии слюны, такие как электрофорез, широко применяются для диагностики системного состояния здоровья. Диагностика с использованием образца слюны стала предпочтительной техникой, поскольку образец легко собрать, а метод является недорогим и неинвазивным.Диагностика слюны даже была идентифицирована как потенциальная замена биомаркеров сывороточного белка. Однако оптимальный протокол сбора слюны еще не установлен. Во многих научных условиях, таких как рандомизированные контролируемые исследования, часто возникают ошибки выборки и статистические ошибки при работе с образцами от здоровых добровольцев. Эти ошибки могут быть связаны с психологическим поведением добровольцев, несоблюдением режима лечения, характеристиками анкеты, методами сбора и / или обработкой выборки.Цель представленного здесь обзора - обрисовать стратегии управления факторами риска и минимизировать ошибки отбора проб во время сбора слюны у здоровых добровольцев.

Ключевые слова: Сбор слюны, здоровые добровольцы, протеомика слюны, психологический стресс, ошибки отбора проб, управление рисками

Введение

Слюна - важный образец в стоматологических исследованиях и в области физиологии полости рта из-за ее пригодности в качестве непригодного инвазивный диагностический инструмент.Слюна использовалась для диагностики различных аутоиммунных заболеваний, диабета, сердечно-сосудистых заболеваний, кариеса и других заболеваний полости рта 1 - 3 . Объем и биохимический состав слюны у разных людей различаются; на эти параметры влияют возраст 4 , пол 5 и диета 6 . Возраст и скорость слюноотделения напрямую влияют на активность альфа-амилазы слюны у здоровых людей 4 . Значительно меньше нестимулированной цельной слюны наблюдалось у здоровых женщин с протезами, не принимавших лекарства, по сравнению с их коллегами-мужчинами 7 .Получение слюны происходит быстро, просто и безболезненно, что делает этот образец несложным инструментом для скрининга болезней 8 . Однако сбор образцов должен быть соответствующим образом оптимизирован, чтобы уменьшить ошибку 9 . Например, метод сбора и продолжительность сбора могут повлиять на измерения активности кортизола и амилазы слюны 9 . Методы сбора и обработки также влияют на измеренную концентрацию общего белка, а также на концентрацию С-реактивного белка и иммуноглобулина (IgA) 8 .Различные факторы, такие как используемые методы анализа и стандарты, влияют на результаты, полученные при оценке слюнной жидкости. Например, образцы слюны, очищенные центрифугированием, показывают более низкие концентрации лизоцима, чем их аналоги в цельной слюне. Кроме того, было показано, что метод анализа на лизопланшете дает более высокие концентрации лизоцима, чем турбидиметрический анализ 10 . Более того, скорость секреции слюны у здоровых людей различна. Поскольку объем различается у разных людей, скорость потока слюны и другие биомаркеры слюны различаются от человека к человеку.В этом обзоре основное внимание уделяется процедуре сбора слюны, факторам, способствующим возникновению ошибки, и стратегиям управления ошибками.

Важность протеомики слюны в биомедицинских технологиях

Исследования, основанные на протеомике слюны, в настоящее время возникают из-за интереса к идентификации прогностических биомаркеров для нескольких физиологических и патологических состояний. Диагностика слюны облегчает раннее обнаружение и диагностику нескольких уровней гормонов и заболеваний полости рта, а также используется для дифференциации пациентов с нормальным контролем и пациентов с системными заболеваниями.Более 3000 белков и пептидов были охарактеризованы с использованием новейших протеомных технологий в слюне человека 11 . В протеоме слюны 12 были исследованы различные состояния и недуги, такие как воспалительные заболевания полости рта, плоскоклеточный рак полости рта, заболевания пародонта, сахарный диабет, СПИД, гепатиты B и C, муковисцидоз и системный склероз. Несколько биомаркеров слюны для диагностики рака полости рта, включая CD44, CD59, антитела p53, M2BP (опухолевый антиген), MRP14, профилин, гистон h2, моэзин, инволюкрин, каталазу, трансферрин, цинковый палец слюны, специфические нитрозамины табака, кератин 36 и цистатин A были исследованы с использованием различных протеомных инструментов, которые были рассмотрены в предыдущих статьях 12 - 14 .Аналогичным образом, NF-kB-зависимые цитокины и иммуносупрессивные цитокины, такие как IL-4, IL-10, IL-13 и IL-1RA, были идентифицированы как потенциальные биомаркеры пренеопластических поражений полости рта и OSCC 15 , 16 . При воспалительных заболеваниях присутствуют различные протеомы слюны; например, синдром Шегрена включает лактоферрин, β2-микроглобулин, полимерный рецептор Ig, лизоцим C, легкую каппа-цепь Ig, цистатин C, карбоангидразу VI и амилазу слюны 17 .Точно так же протеомика слюны также способствовала раннему выявлению и пониманию нейропсихиатрических заболеваний, например аутизма, снижения когнитивных способностей и депрессии 18 . Высокотехнологичные протеомные инструменты, включая HPLC, ELISA, иммуноблот, LC / MS, масс-спектрометрию, 2D-электрофорез, протеомику на основе MS, технологию MALDI-TOF MS, ПЦР, иммуно-радиометрический анализ и многие другие, используются для идентификации нескольких биологических маркеров. 13 .

Рекомендации по отбору проб

Требования к отбору проб

Хотя для сбора слюны не требуется обширная подготовка, подходящие участники должны получить соответствующие инструкции.Правильный сбор образцов требует точной идентификации участников, достаточного объема образца и подходящего типа контейнера. Более того, маркировка образцов и обращение с ними должны выполняться последовательно.

Выбор по возрасту и полу

Слюна состоит из многих компонентов, включая воду, электролиты, ферменты и антимикробные агенты. Эти компоненты могут изменяться или оставаться стабильными с возрастом 19 . Например, у пожилых людей наблюдалось снижение скорости потока слюны и кальция по сравнению с молодыми людьми, тогда как уровни матриксной металлопротеиназы-8 и коллагеназы-1 значительно повышались с неизмененной альфа-амилазой слюны 19 .Однако другой предыдущий отчет показал значительное снижение активности альфа-амилазы у пожилых людей и отсутствие изменений в скорости секреции и уровне кальция в слюне 20 . Точно так же значительная разница в уровнях муцина была обнаружена во всей слюне молодых и пожилых субъектов 21 . Удивительно, но новорожденные и взрослые также продемонстрировали различия в профилях белков слюны 22 , 23 . Протеом слюны человека, такой как белки, богатые пролином, уровни пептидов, кислые фосфопротеины, богатые пролином, гистатины и цистатин S, был исследован в разных возрастных группах и обнаружил, что протеом слюны человека значительно варьируется в детском и подростковом возрасте 23 .Аналогичным образом, в предыдущем исследовании наблюдалась высокая скорость слюноотделения у здоровых добровольцев моложе 44 лет 24 . Нестимулированная секреция слюны была выше у здоровых мужчин по сравнению с женщинами, где автор предположил, что размер слюнной железы влияет на секрецию слюны, поскольку размер слюнной железы у женщин меньше, чем у мужчин 24 , 25 , что указывает на секрецию, зависящую от пола. Поэтому здоровых добровольцев из разных возрастных групп и полов следует классифицировать отдельно, чтобы ограничить статистические ошибки.

Значение положения рта во время сбора слюны

Различные пары слюнных желез включают околоушные, подчелюстные, подъязычные и многочисленные второстепенные слюнные железы. Хотя слюна, выделяемая этими железами, содержит некоторые общие компоненты, их концентрация может варьироваться от одной железы к другой 26 . Например, околоушные железы содержат большое количество серозных ацинарных клеток и вырабатывают высокие уровни альфа-амилазы и белков, богатых пролином.Хотя подчелюстные железы выделяют меньше альфа-амилазы, чем околоушные железы, они секретируют больше муцинов. Подъязычные железы в основном состоят из слизистых клеток и содержат высокие концентрации гликопротеинов (муцинов) и большое количество лизоцима. Малые слюнные железы в основном продуцируют муцины и липазу 26 .

Цельная слюна представляет собой смесь слюны, выделяемой в ротовую полость различными железами в дополнение к другим компонентам, таким как назальный и бронхиальный секрет, остатки пищи, слезы, бактерии и жидкость десневой щели 27 .Кроме того, производство слюны, ее компоненты и ее происхождение зависят от того, находится ли человек в состоянии покоя или в состоянии стимуляции. Например, стимуляция влияет на уровни кортизола, альфа-амилазы и секреторного IgA 26 . Исследователи должны учитывать, что производство и состав слюны каждой железой различны, и соответствующим образом проинструктировать людей. Каждый человек должен строго следить за литературой, касающейся методов сбора слюны.Такая последовательность в методе сбора важна, поскольку обеспечивает высокое качество данных.

Измерение объема слюны перед исследованием, представляющим интерес в исследовании плацебо: выберите только лиц, получивших промежуточную оценку

Чтобы исключить ошибки в клинических испытаниях с использованием слюны здоровых добровольцев, процедуры сбора должны быть стандартизованы. Секреция слюны варьируется у разных людей. Если один и тот же человек собирает слюну в разные моменты времени, будут получены разные скорости потока слюны, что затрудняет интерпретацию 28 .Чтобы свести к минимуму ошибку, люди, секретирующие большие объемы слюны, и люди, секретирующие малые объемы, должны быть исключены из исследования, и должны быть включены только участники с промежуточной оценкой.

Предоставьте подробную информацию о методе сбора слюны.

Для сбора цельной слюны доступны различные методы. Общие методы включают метод слива, метод сплевывания, метод всасывания и метод тампона 27 . Точно так же несколько имеющихся в продаже устройств и методов можно использовать для сбора слюны из отдельных желез 27 .Участники должны получить надлежащие инструкции о том, как лучше всего выполнить сбор проб. Настоятельно рекомендуется использовать только один тип устройства для сбора в течение данного исследования 29 . Также не рекомендуется использовать тампон или метод аспирации для сбора нестимулированной цельной слюны, поскольку действие тампона обеспечивает некоторую степень стимуляции и, таким образом, увеличивает вариабельность 27 . Предыдущее исследование показало, что биомаркеры слюны, такие как ДГЭА, тестостерон, эстрадиол и прогестерон, были статистически значимыми (p <0.005) и sIgA значительно снизился (p <0,005) в методах сбора на основе хлопка по сравнению с методами без использования хлопка, однако котинин и кортизол не пострадали, что указывает на то, что метод сбора является значительным источником несистематической ошибки 30 . Кроме того, образцы, полученные с помощью плевания, содержат больше бактерий, чем образцы, полученные с помощью слюноотделения, что может повлиять на дальнейший анализ соединений слюны 31 . Метод пассивного слюноотделения считается многообещающей альтернативой для минимизации этих потенциальных источников ошибок.Более того, с помощью метода пассивного слюноотделения можно собрать большие объемы слюны за короткое время 32 .

Хранение образцов

Если анализ должен быть выполнен немедленно, образцы можно хранить при комнатной температуре (максимум 30-90 мин) 31 . Однако в статье, опубликованной Thomadaki K et al., Предполагается, что снижение температуры инкубации снижает скорость деградации протеома слюны 33 . Таким образом, сразу после сбора слюны рекомендуется заморозить образцы при -20 ºC или ниже.Если морозильная камера недоступна, образцы можно хранить при 4 ºC, чтобы предотвратить рост бактерий и дальнейшее разложение молекул слюны (не более 6 часов) 31 . Образцы также можно хранить при -80 ºC в течение нескольких лет с незначительной деградацией или без нее. 31 , 34 . Всегда лучше всего провести аликвотирование и заморозить образцы, чтобы избежать повторяющихся циклов замораживания-оттаивания. Другие подходы к хранению и обработке образцов, включая мгновенное замораживание в жидком азоте и использование ингибиторов ферментов, описаны в предыдущих исследованиях 31 , 35 .Для анализа РНК ингибитор РНКазы следует добавить во фракции супернатанта (не в осадок) перед хранением при -80 ºC 36 . Однако недавно открытый метод QIAzol показал способность выделять высокие выходы РНК без необходимости в дополнительном стабилизаторе РНК. Используя этот метод, образцы слюны можно успешно хранить более 2 лет при -80 ºC без добавления ингибиторов РНКаз 37 .

Влияет ли психологический стресс на секрецию белка слюны?

Различные отчеты предполагают, что психологический стресс вызывает уровни альфа-амилазы и кортизола в слюне, и эти факторы стресса могут включать публичные выступления, просмотр фильмов с напряжением, стоматологические процедуры, осмотры, спортивные соревнования, приключения e.г., банджи-джампинг и т. д. 38 - 41 . Более того, уровень амилазы в слюне реагировал быстрее, чем кортизол, во время психологического стресса, что могло быть лучшим индикатором стресса 38 . Однако стресс во время стоматологического лечения показал значительные изменения в уровнях кортизола и sIgA в слюне, чем альфа-амилаза 42 . Во время острого стресса содержание нитратов и нитритов в слюне значительно увеличивается, что играет важную роль в защите желудка от стресса.Это исследование было продемонстрировано при остром стрессе, вызванном банджи-джампингом 43 . Другое интересное исследование предполагает роль стресса в секреции слюны во время спортивных соревнований, когда требуется высокая умственная активность, чтобы столкнуться с противником. В ходе исследования исследователи обнаружили, что у победителей был более высокий уровень кортизола в слюне перед соревнованиями, что указывало на психофизиологическое возбуждение, и им удавалось контролировать стресс во время соревнований, что указывало на более высокую скорость слюноотделения и более высокую секрецию sIgA 44 .Предыдущее исследование выявило значительное повышение уровня кортизола в слюне, которое наблюдалось в хронических (учеба и подготовка к экзаменам) и острых (экзамен) ситуациях учебного поведения 45 . Кроме того, на уровень кортизола в слюне и сыворотке влияют различные факторы стресса, включая бессонницу, депрессию и усталость. На усталость, вызванную бессонницей или другими факторами, могут влиять циркадные ритмы 46 . Амилаза слюны также была идентифицирована как биомаркер депривации сна у дрозофилы и человека.Уровни мРНК амилазы неуклонно повышаются во время бодрствования, несмотря на отсутствие изменений в объеме общего белка слюны 47 .

В случае предменструального синдрома (ПМС) женщины принимают психосоматические изменения, депрессию и боль в груди во время или перед менструацией 48 , 49 . Было обнаружено, что концентрация sIgA значительно повышается во время предменструальной или менструальной фазы по сравнению с постменструальной фазой. Напротив, более высокий уровень sIgA чаще наблюдался у женщин с дисменореей по сравнению с женщинами без дисменореи.Однако корреляции между ПМС и уровнем кортизола не было 49 . Во время теста социального стресса Триера (TSST) было обнаружено, что после теста уровень цистатина S, альфа-амилазы и легкой цепи IgA, глутатион-S-трансферазы и PIP (пролактин-индуцируемый белок) был выше 50 . Кроме того, уровень IL-6 в слюне был сильно повышен (приблизительно на 50%) и сохранялся в течение 20 минут у здоровых молодых людей в ответ на TSST 51 . Острый стресс активирует ось HPA и SNS, производя высокие уровни кортизола и альфа-амилазы 52 .Другой профиль состояний настроения (ПОМС) также влияет на уровень кортизола и альфа-амилазы в слюне 52 . Кроме того, исследователи также продемонстрировали вызванное стрессом повышение уровня кортизола при стратегическом поведении во время игры-конкурса красоты 53 . Было обнаружено, что при остром стрессе, вызванном публичными выступлениями, на динамические изменения, такие как концентрация кортизола, внутриротовой pH и концентрация общего белка, влияют без изменения концентрации фторида в слюне 54 .

На основании вышеупомянутых отчетов мы можем предположить, что слюнный поток и секреторные белки могут варьироваться у здоровых людей. Эти вариации могут быть связаны либо с POMS, например, депрессией, гневом, усталостью, либо с авантюризмом, либо с любым стратегическим поведением. Итак, во время сбора слюны нам необходимо подтвердить от здоровых добровольцев, что они свободны от такого психологического стресса, который напрямую влияет на объем слюны или слюнные белки. Нам необходимо разделить на разные группы или исключить таких добровольцев, чтобы ограничить статистические ошибки.Ошибки, вызванные несоблюдением требований, могут значительно ухудшить результаты постанализа.

Анкета

Каждый участник должен заполнить анкету, чтобы предоставить информацию о своем состоянии и тяжести. Более того, до того, как участник заполнит анкету 55 , необходимо записать историю определенных заболеваний, возраст и пол. Мы разделили анкету на разные разделы: социально-демографическая информация (таблица), история болезни (таблица), табачные и алкогольные привычки (таблица), гигиена полости рта (таблица) и другие (например,g., нарушение сна и речи) (таблица). Разделы показаны ниже в виде таблицы.

Таблица 1

Демографические характеристики и личная информация

до старшего
Анкета Ответ Ссылки
Пол Мужчины / Женщины / Другой возраст 55, 56 55, 56
55, 56
Вес (кг) Килограммы (кг) 56
Рост (см) 56
ИМТ (кг / м 2 ИМТ (кг / м ) Меньше / нормально / больше / ожирение 56, 57
Уровень образования 55
Страна рождения 55

903 Таблица 2

9039 Ответ Список литературы У вас системное заболевание? Да / Нет 58 Принимаете ли вы лекарства ежедневно? Да / Нет Если вы принимаете лекарства, какие лекарства / препараты вы принимаете? Типы лекарств 55, 59, 60 У женщин-добровольцев нормально ли протекают месячные? Да / Нет 61 Если у вас ненормальные месячные, когда были ваши последние месячные? дней Оцените стресс (умственный / физический) и тревогу в вашей повседневной жизни. 0-10 баллов 62 Проходили ли вы когда-нибудь лучевую терапию головы или шеи? Да / Нет Страдали ли вы когда-нибудь от заболеваний слюнных желез? Да / Нет 58 Страдали ли вы когда-нибудь артритом или каким-либо другим аутоиммунным заболеванием? Да / Нет 58 Есть ли у вас аллергия? Да / Нет У вас диабет? Да / Нет 63

Таблица 3

Табачные и алкогольные привычки

Анкета Ответ Ссылки
Вы курите? Да / Нет 55, 64
Если да, сколько сигарет вы выкуриваете в день? Сигарет в день 55
Используете ли вы табачные изделия, такие как табачные листья или табачный порошок? Да / Нет 64
Употребляете ли вы алкоголь или другие напитки (например,г., газированные напитки)? Да / Нет (укажите) 55, 65
Если да, какой объем вы потребляете в день? мл / день 55

Таблица 4

Анкета Ответ Ссылки
Есть ли у вас поражение / язвы в полости рта Да / Нет 55, 66
Вы чувствуете жжение во рту? Да / Нет 55, 57
Ощущается ли сухость во рту? Да / Нет 55, 67, 68
У вас неприятный запах изо рта? Да / Нет 55
Вы носите зубные протезы? Да / Нет 55, 57
Используете ли вы зубную пасту ежедневно? Да / Нет 55
Используете ли вы зубную нить ежедневно? Да / Нет 55
Используете ли вы жидкость для полоскания рта ежедневно? Да / Нет 55

Таблица 5

Анкета Ответ Ссылки
Ощущается ли сухость во рту во время еды? Да / Нет 60, 67
Испытываете ли вы трудности с проглатыванием сухого корма? Да / Нет 67, 69
Кажется, у вас слишком мало слюны во рту? Да / Нет 60, 67
Часто ли вы пьете воду или сок? Да / Нет
Если да, какой объем вы потребляете в день? мл / день
Испытываете ли вы трудности при разговоре? Да / Нет 69
Есть ли у вас проблемы со сном из-за сухости? Да / Нет 65, 69
Вы сосете сладкое или жуете жвачку, чтобы уменьшить сухость во рту? Да / Нет 65, 70
Ваша кожа лица кажется сухой? Да / Нет 65, 70
Ваши глаза кажутся сухими? Да / Нет 68, 70
Ваши губы сухие? Да / Нет 65, 70
Ощущается ли сухость во внутренней части носа? Да / Нет 70
Ощущается ли сухость в горле? Да / Нет 63, 71

На каждый вопрос следует ответить «да» или «нет».Если человек отвечает «да», следует записать частоту и тяжесть состояния. Если человек испытывает ксеростомию, ответ следует записать по 10-балльной шкале (от 0 = не сухо до 10 = очень сухо).

Критерии включения

Участников следует отбирать на основе следующих критериев.

  • Участники должны быть в возрасте 18 лет и старше. Примечание. Лица моложе 18 лет могут не понимать анкету, могут не понимать форму согласия, неправильно заполнять форму согласия или не следовать инструкциям.Более того, люди в возрасте 60 лет и старше не должны участвовать в исследовании. Хотя в остальном эти люди могут быть здоровыми, частота гипосаливации у пожилых людей выше, чем у молодых людей 60 .

  • Участники должны уметь читать, заполнять и подписывать форму согласия.

  • Участники должны понять анкету и ответить на нее.

  • Добровольцы должны быть здоровы, особенно в отношении слюнных желез и слизистой оболочки полости рта 68 .

  • У участников не должно быть сухости во рту или сухости глаз.

Критерии исключения

  • Участники младше 18 лет.

  • Участники, которые не могут прочитать или понять форму согласия.

  • Лица, ответившие «да» на вопрос, связанный с сухостью. Эти люди считаются положительными на ксеростомию и не могут участвовать в исследовании.

  • Беременные.

  • Участники, жалующиеся на сухость во рту или сухость глаз 68 .

  • Пациенты с поражениями полости рта или другой контактной чувствительностью 66 .

  • Пациенты, страдающие аутоиммунными заболеваниями, такими как синдром Шегрена, ревматоидный артрит, системная красная волчанка или прогрессирующий системный склероз, поскольку у лиц с этими аутоиммунными воспалительными заболеваниями наблюдается стойкая ксеростомия 58 , 72.

  • Лица, остро или хронически употребляющие лекарства, вызывающие сухость во рту 66 . К ним относятся такие препараты, как антигистаминные, антипсихотические и антидепрессанты 58 , 59 .

  • Пациенты, проходящие лучевую терапию (в основном для лечения рака головы и шеи).

  • Лица с хроническим заболеванием, если оно не контролируется должным образом.

  • Лица, инфицированные ВИЧ, гепатитом B или C.

Ошибка отбора и управление пробой

Вероятность ошибки при отборе проб наиболее высока во время сбора и обработки слюны. Неправильные методы сбора слюны также приводят к ошибке отбора пробы 73 . Исследователь должен использовать ответы на вопросы анкеты, чтобы выбрать подходящих добровольцев. Лучше выбрать популяцию с промежуточной оценкой, чтобы минимизировать возможные вариации скорости слюноотделения. Во время сбора слюны следует ограничить употребление еды и напитков.Однако в некоторых случаях пищу можно съесть за 30 минут 32 за 1 час до того, как плюнуть 9 . Пациенту следует прополоскать рот деионизированной водой и подождать не менее 10 минут, прежде чем предоставить образец 32 . Четкая и понятная маркировка необходима для правильной идентификации образцов и обращения с ними. Для длительного хранения настоятельно рекомендуется использовать перманентные маркеры или этикетки со штрих-кодом. 34 .

Оптимальная методика отбора проб перед взятием (как указано в разделах 3.3 и 3.5) следует тщательно выбирать в зависимости от возраста и интересующего эксперимента. Участники должны быть проинструктированы об оптимальном размещении и сроке действия устройства или тампона, чтобы обеспечить точность измерения аналитов. Собранная слюна не должна содержать твердых частиц или других мешающих веществ 32 . Загрязнение образца можно предотвратить, надев перчатки и используя чистые материалы для сбора 74 . После сбора образец следует хранить или обрабатывать соответствующим образом, как описано в разделе 3.6. Некоторые аналиты слюны, такие как дегидроэпиандростерон, эстрадиол и прогестерон, очень чувствительны к замораживанию-оттаиванию, поэтому следует избегать многократных циклов замораживания-оттаивания 32 .

К другим влияющим факторам относятся возраст, половая принадлежность и среда проживания. Было показано, что продолжительность и временной интервал сбора образцов влияет на концентрацию аналитов, в основном на маркеры стресса, такие как кортизол, секреторный иммуноглобулин A и хромогранин A 74 . Сбор слюны у здоровых добровольцев подобен наблюдательному исследованию, в котором участников следует выбирать на основе ответов на анкету, подробных историй болезни и полных клинических обследований, если применимо.Различные аспекты соблюдения режима сбора слюны у здоровых добровольцев могут минимизировать ошибку отбора проб. Эти аспекты кратко представлены на рисунке.

Четыре этапа сбора слюны у здоровых добровольцев

Чтобы преодолеть колебания от образца к образцу, необходимо измерить выход слюны у каждого человека. В частности, каждого человека следует классифицировать как выделяющего высокий, средний или низкий объем слюны. Скорость слюноотделения у здоровых людей различается 75 .Это изменение напрямую влияет на общую концентрацию и ферментативную активность белков, таких как альфа-амилаза слюны, у здоровых молодых людей, даже в отсутствие стрессового стимула 4 . Скорость потока слюны, общая концентрация белка в слюне и осмоляльность слюны являются потенциальными маркерами состояния гидратации всего тела и могут колебаться во время острого обезвоживания 76 . Коэффициенты нормализации (например, концентрация креатинина в образцах мочи) 77 для образцов слюны еще не установлены; однако измерение концентрации общего белка постоянно используется для нормализации концентрации аналитов в слюне, поскольку различные стимуляции могут влиять на концентрацию общего белка в слюне 78 , 79 .Согласно предыдущему исследованию, увеличение скорости потока слюны фактически уменьшило общую концентрацию белка в образцах слюны 78 . Однако в одном исследовании авторы обнаружили, что концентрация белка в образцах слюны не была сильно связана с объемом слюны, но была связана с концентрацией СРБ в слюне. Считается, что это открытие важно для популяции новорожденных, у которой объем слюны сильно колеблется 80 .

Циркадные и суточные ритмы также влияют на нестимулированный расход слюны 81 , 82 , в дополнение к концентрациям натрия и калия 81 .Следовательно, чтобы гарантировать получение стабильных результатов, людей следует отбирать на основе скорости их слюноотделения (а не объема слюны). В исследование следует включать только тех, у кого секреция слюны находится в среднем диапазоне. Более того, время сбора исходного образца должно быть установлено примерно в одно и то же время каждый день для всех людей, чтобы минимизировать вариабельность 82 .

Другой метод уменьшения вариабельности выборки - это попытка собрать образцы в несколько дней.Участников следует попросить собирать образцы в разные дни (например, в течение 5 дней) в указанное время и при определенных условиях (как указано в разделе 2). Образцы можно собирать дома или в центре сбора. Собираются все образцы и исследуются основные биомаркеры, такие как скорость слюноотделения, концентрация общего белка и ферменты слюны (например, альфа-амилаза). Этот метод помогает определить, в какой степени участники соблюдали соответствующие руководящие принципы 83 .Участники с хорошим соблюдением протокола и с минимальным количеством ошибок или без них в течение многодневного периода сбора данных будут выбраны для дальнейших клинических испытаний как здоровые добровольцы (рисунок). Для любого типа испытания лекарственного средства необходимо сравнивать результаты пациентов с болезнью и здоровых людей; этот шаг включен в следующую фазу клинического испытания.

Процесс сбора образцов (слюны) для минимизации индивидуальной вариабельности

Обсуждение и выводы

Мы разработали стратегический протокол сбора слюны у здоровых добровольцев.В различных исследованиях изучалась эффективность вмешательств для лечения ксеростомии и других осложнений, связанных с сухостью. В клинических испытаниях проводится статистический анализ для сравнения результатов здоровых участников с результатами пациентов. Правильный сбор слюны у здоровых добровольцев необходим для минимизации ошибки отбора проб. Оптимизированный протокол для оценки образцов слюны здоровых людей еще не разработан, и Национальные институты здравоохранения все еще набирают здоровых добровольцев для оценки слюны 84 .Более того, многие исследования здоровых добровольцев не включали подробные анкеты, что увеличивает ошибку выборки. Более того, неадекватные анкеты могут не получить достаточной информации для отбора подходящих лиц. Мы стремились собрать эту информацию, добавив анкету, которая помогает определить, удовлетворяют ли здоровые добровольцы критериям включения или исключения. Эти вопросы могут снизить риск неточного измерения аналитов слюны у здоровых людей (Таблицы -).

Загрязнение слюны кровью или другими веществами может помешать иммуноанализу после сбора. Участники исследования, сдающие слюну, должны знать несколько факторов. Во-первых, употребление алкоголя менее чем за 12 часов до сбора слюны может повлиять на состав слюны. Точно так же потребление пищи, содержащей продукты с высоким содержанием сахара, высокой кислотности и / или кофеина, может снизить pH слюны и, таким образом, увеличить рост бактерий. Добровольцев также следует проверять на предмет гигиены полости рта, травм полости рта и привычки чистить зубы.Кроме того, необходимо документально подтвердить использование лекарств и никотина 85 .

Еще одним фактором, ответственным за ошибку выборки, является устройство для сбора. Как описано в разделе 2, было разработано несколько методов и устройств для сбора слюны. Вдобавок недавно был разработан Muddler 86 . Это устройство может использоваться как с младенцами, так и со взрослыми и может эффективно собирать постоянный объем слюны. Кроме того, это устройство очень полезно для исследований, связанных со стрессом и иммунитетом, а также для других анализов биомаркеров слюны 86 .Однако особое внимание следует уделить хранению образцов перед анализом 87 .

При правильном обращении со слюной биомаркеры слюны, такие как ферменты и белки (например, альфа-амилаза) 4 , стрессовые белки (например, GRP78) 3 , 88 и HSP70 89 , инфекционные заболевания (например, ВИЧ), плоскоклеточный рак полости рта 90 , 91 и маркеры неоплазии CA125 92 могут быть эффективно оценены.Кроме того, могут быть использованы аналиты, такие как гормоны, стероиды, антитела, факторы роста, цитокины, хемокины, нуклеиновые кислоты и белки, связанные с различными системными заболеваниями, психологическими исследованиями, аутоиммунными заболеваниями и заболеваниями полости рта (вызванными грибками, вирусами и бактериями). успешно реализовано в диагностических приложениях 87 .

Благодарности

Работа выполнена при поддержке Программы совместных исследований для развития сельскохозяйственных наук и технологий (проект №PJ01158104 и PJ01389701), финансируемая Администрацией сельского развития Республики Корея. Это исследование также было поддержано Программой развития био- и медицинских технологий (NRF-2017M3A9E4047243), финансируемой Министерством науки, ИКТ и планирования будущего Республики Корея.

Аббревиатуры

910C карцином
CRP C-реактивный белок
Ig Иммуноглобулин
sIgA Секреторный иммуноглобулин A Сквотный клеточный иммуноглобулин A
A Синдром необходимого иммунодефицита
CD Кластер дифференцировки
HPA Гипоталамо-гипофизарно-надпочечниковый
SNS SNS Симпатическая нервная система связывающий белок
MRP14 Миелоид-родственный белок 14
NF-kB Ядерный фактор-каппа B
IL Интерлейкин
Жидкостная хроматография 90-407 ВЭЖХ
ELISA Ферментно-связанный иммуноферментный анализ
ЖХ / МС Жидкостная хроматография-масс-спектрометрия
MALDI-TOF MS Матричная лазерная десорбция / время ионизации-времяпролетного масс-спектрометра PC7 Полимеразная цепная реакция
GRP78 Глюкозо-регулируемый белок 78
HSP70 Белок теплового шока 70.

Ссылки

1. Джавид М.А., Ахмед А.С., Дюран Р., Тран С.Д. Слюна как средство диагностики заболеваний полости рта и системных заболеваний. Журнал биологии полости рта и черепно-лицевых исследований. 2016; 6: 66–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 2. Бхаттарай К.Р., Ли С.В., Ким С.Х., Ким Х.Р., Чае Х.Дж. Экстракт Ixeris dentata регулирует секрецию слюны за счет активации аквапорина-5 и предотвращает ксеростомию, вызванную диабетом. Журнал экспериментальной фармакологии. 2017; 9: 81–91. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3.Бхаттарай К.Р., Ли Х.Й., Ким С.Х., Ким Х.Р., Чае Х.Дж. Экстракт Ixeris dentata увеличивает секрецию слюны за счет регуляции стресса эндоплазматической сети на модели крыс с ксеростомией, вызванной диабетом. Международный журнал молекулярных наук. 2018; 19 (4): 1059. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Архакис А., Карагианнис В., Калфас С. Активность альфа-амилазы в слюне и скорость слюноотделения у молодых людей. Журнал открытой стоматологии. 2013; 7: 7–15. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5.Лукач-младший, Ларгаэспада LL. Объяснение половых различий в распространенности кариеса зубов: слюна, гормоны и этиология "анамнеза". Американский журнал биологии человека: официальный журнал Совета по биологии человека. 2006; 18: 540–55. [PubMed] [Google Scholar] 6. Дауэс К. Влияние диеты на секрецию и состав слюны. Журнал стоматологических исследований. 1970; 49: 1263–73. [PubMed] [Google Scholar] 7. Сундус Исмаил Аль-Аззави, Алия Махмуд Альван, Салал Р.Х. Влияние возраста и пола на скорость слюноотделения у пациентов с полной адентией.MDJ. 2013; 10: 64–8. [Google Scholar] 8. Мохамед Р., Кэмпбелл Дж. Л., Купер-Уайт Дж., Димески Дж., Пуньядира С. Влияние методов сбора и обработки слюны на иммуноанализы CRP, IgE и миоглобина. Клиническая и трансляционная медицина. 2012; 1:19. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Белцер Е.К., Фортунато СК, Гуадеррама М.М., Пекинс М.К., Гаррамоне Б.М., Грейнджер Д.А. Слюноотделение и альфа-амилаза: метод сбора, продолжительность и тип ротовой жидкости. Физиология и поведение. 2010; 101: 289–96.[PubMed] [Google Scholar] 10. Jenzano JW, Hogan SL, Lundblad RL. Факторы, влияющие на измерение лизоцима слюны человека в лизопластинчатых и турбидиметрических анализах. Журнал клинической микробиологии. 1986; 24: 963–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Castagnola M, Scarano E, Passali GC, Messana I, Cabras T., Iavarone F. et al. Биомаркеры слюны и протеомика: будущие диагностические и клинические возможности. Acta otorhinolaryngologica Italica: Organo ufficiale della Societa italiana di otorinolaringologia e chirurgia cervico-facciale.2017; 37: 94–101. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12. Аль Кавас С., Рахим Ж., Фергюсон Д.Б. Возможное использование анализа белков слюны человека и пептидов в диагностике заболеваний. Архив устной биологии. 2012; 57: 1–9. [PubMed] [Google Scholar] 13. Саннам Хан Р., Хуршид З., Ахбар С., Фараз Мойн С. Достижения протеомики слюны при обнаружении плоскоклеточной карциномы полости рта (OSCC): обновление. Протеомы. 2016; 4 (4): 41. [Бесплатная статья PMC] [PubMed] [Google Scholar] 14. Ху С., Арельяно М., Бунхын П., Ван Дж., Чжоу Х., Цзян Дж.и другие. Протеомика слюны для открытия биомаркеров рака полости рта. Клинические исследования рака: официальный журнал Американской ассоциации исследований рака. 2008; 14: 6246–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Родус Н.Л., Хо В., Миллер С.С., Майерс С., Ондри Ф. Уровни цитокинов, зависимых от NF-kappaB, в слюне пациентов с пренеопластическими поражениями полости рта и плоскоклеточным раком полости рта. Обнаружение и профилактика рака. 2005; 29: 42–5. [PubMed] [Google Scholar] 16. Азиз С., Ахмед С.С., Али А., Хан Ф.А., Зульфикар Г., Икбал Дж.и другие. Иммуносупрессивные цитокины IL-10 и IL-13 слюны значительно повышены у пациентов с плоскоклеточной карциномой полости рта. Расследование рака. 2015; 33: 318–28. [PubMed] [Google Scholar] 17. Рю ОХ, Аткинсон Дж.С., Хоэн Г.Т., Иллей Г.Г., Харт ТС. Идентификация биомаркеров околоушной слюны при синдроме Шегрена с помощью поверхностно-усиленной лазерной десорбции / ионизации времяпролетной масс-спектрометрии и двумерного разностного гель-электрофореза. Ревматология. 2006; 45: 1077–86. [PubMed] [Google Scholar] 18.Полынь К.Л., Аслебаг Р., Чаннавираппа Д., Дюпри Э.Дж., Борланд М.М., Райан Дж. П. и другие. Протеомика и биомаркеры слюны в неврологии и психиатрии. Протеомика Клинические приложения. 2015; 9: 899–906. [PubMed] [Google Scholar] 19. Нассар М., Хираиши Н., Ислам М.С., Оцуки М., Тагами Дж. Возрастные изменения биомаркеров слюны. Журнал стоматологических наук. 2014; 9: 85–90. [Google Scholar] 20. Бен-Арье Х., Шалев А., Саргель Р., Лаор А., Лауфер Д., Гутман Д. Скорость слюны и состав цельной и околоушной слюны в покое и стимулированной слюны у молодых и старых здоровых субъектов.Биохимическая медицина и метаболическая биология. 1986; 36: 260–5. [PubMed] [Google Scholar] 21. Denny PC, Denny PA, Klauser DK, Hong SH, Navazesh M, Tabak LA. Возрастные изменения муцинов цельной слюны человека. Журнал стоматологических исследований. 1991; 70: 1320–7. [PubMed] [Google Scholar] 22. Inzitari R, Vento G, Capoluongo E, Boccacci S, Fanali C, Cabras T. et al. Протеомный анализ кислых белков с высоким содержанием пролина в слюне у недоношенных и доношенных новорожденных. Журнал протеомных исследований. 2007; 6: 1371–7. [PubMed] [Google Scholar] 23.Кабрас Т., Пизано Э., Бой Р., Олианас А., Манкони Б., Инзитари Р. и др. Возрастные модификации секреторного белкового комплекса слюны человека. Журнал протеомных исследований. 2009. 8: 4126–34. [PubMed] [Google Scholar] 24. Фенолл-Паломарес С., Муньос Монтагуд СП, Санчиз В., Эррерос Б., Эрнандес В., Мингес М. и др. Нестимулированный расход слюны, pH и буферная способность слюны у здоровых добровольцев. Revista espanola de enfermedades digestivas: официальный орган общества испанской патологии.2004. 96: 773–83. [PubMed] [Google Scholar] 25. Скотт Дж. Возраст, пол и контралатеральные различия в объемах подчелюстных слюнных желез человека. Архив устной биологии. 1975. 20: 885–7. [PubMed] [Google Scholar]

26. Салиметрия. Важность расположения рта во время сбора слюны. 1-7.

27. Навазеш М. Методы сбора слюны. Летопись Нью-Йоркской академии наук. 1993; 694: 72–7. [PubMed] [Google Scholar]

28. Рантонен П. Слюноотделение и состав у здоровых и больных взрослых.2003.

29. Голатовски С., Салазар М.Г., Допл В.М., Хаммер Э., Кочер Т., Джемлих Н. и др. Сравнительная оценка методов сбора слюны для протеомного анализа. Clinica chimica acta; международный журнал клинической химии. 2013; 419: 42–6. [PubMed] [Google Scholar] 30. Руберклифф Э.А., Грейнджер Д.А., Шварц Э., Карран М.Дж. Использование биомаркеров слюны в биоповеденческих исследованиях: методы сбора образцов на основе хлопка могут повлиять на результаты иммуноанализа слюны. Психонейроэндокринология. 2001; 26: 165–73.[PubMed] [Google Scholar] 31. Чиаппин С., Антонелли Г., Гатти Р., Де Пало Э. Ф. Образец слюны: новый лабораторный инструмент для диагностики и фундаментальных исследований. Clinica chimica acta; международный журнал клинической химии. 2007; 383: 30–40. [PubMed] [Google Scholar] 32. Грейнджер Д.А., Джонсон С.Б., Сантон С.Л., Аут Д., Шуман Л.Л. Включение биомаркеров слюны в исследования медсестер: обзор и обзор передовой практики. Биологические исследования для медсестер. 2012; 14: 347–56. [Бесплатная статья PMC] [PubMed] [Google Scholar] 33.Томадаки К., Хелмерхорст Э.Д., Тиан Н., Сан X, Сикейра В.Л., Уолт Д.Р. и другие. Протеолиз цельной слюны и его влияние на диагностику слюны. Журнал стоматологических исследований. 2011; 90: 1325–30. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Salimetrics L, SalivaBio L. Советы по отбору слюны и обращению с ней. Салиметрия. 2015; 3 (3-е издание): 1–15. [Google Scholar] 35. Нуркка А., Обиеро Дж., Кайхти Х., Скотт Дж. А. Влияние методов сбора и хранения образцов на антипневмококковый иммуноглобулин А в слюне. Клинико-диагностическая лабораторная иммунология.2003. 10: 357–61. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Хенсон Б.С., Вонг Д.Т. Сбор, хранение и обработка образцов слюны для последующих молекулярных приложений. Методы молекулярной биологии. 2010; 666: 21–30. [PubMed] [Google Scholar] 37. Pandit P, Cooper-White J, Punyadeera C. Метод экстракции РНК с высоким выходом из слюны. Клиническая химия. 2013; 59: 1118–22. [PubMed] [Google Scholar] 38. Такай Н., Ямагути М., Арагаки Т., Это К., Учихаши К., Нисикава Ю. Влияние психологического стресса на уровни кортизола и амилазы в слюне у здоровых молодых людей.Архив устной биологии. 2004; 49: 963–8. [PubMed] [Google Scholar] 39. Нейтек В.А. События с высоким и низким уровнем эмоций влияют на восприятие эмоционального стресса и связаны с изменениями реакции кортизола в слюне в последовательной парадигме стресса. Психонейроэндокринология. 2002; 27: 337–52. [PubMed] [Google Scholar] 40. Хенниг Дж., Лашефски У., Оппер С. Биопсихологические изменения после банджи-джампинга: иммунореактивность бета-эндорфина как медиатор эйфории? Нейропсихобиология. 1994; 29: 28–32. [PubMed] [Google Scholar] 41.ван ден Бос Э, де Рой М, Мерс АС, Бохорст ЦЛ, Вестенберг ПМ. Повышение стрессовой реакции подростков на социальную оценку: влияние пубертата на кортизол и альфа-амилазу во время публичных выступлений. Развитие ребенка. 2014; 85: 220–36. [PubMed] [Google Scholar] 42. Охура К., Нодзаки Т., Шинохара М., Дайто К., Сономото М., Дайто М. Полезность биомаркера слюны для стресса, вызванного стоматологическим лечением. Обзор японской стоматологии. 2012; 48: 14–7. [Google Scholar] 43. Цзинь Л., Цинь Л., Ся Д, Лю Х, Фань З, Чжан К.и другие. Активная секреция и защитный эффект нитрата слюны от стресса у людей-добровольцев и крыс. Свободнорадикальная биология и медицина. 2013; 57: 61–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 44. Папакоста Э., Насис Г.П., Глисон М. Гормоны слюны и беспокойство у победителей и проигравших международных соревнований по дзюдо. Журнал спортивных наук. 2016; 34: 1281–7. [PubMed] [Google Scholar] 45. Гонсалес-Кабрера Дж., Фернандес-Прада М, Ирибар-Ибабе С., Пейнадо Дж. М.. Острый и хронический стресс увеличивает уровень кортизола в слюне: исследование в реальных условиях национального экзамена, проведенного выпускниками медицинских вузов.Стресс. 2014; 17: 149–56. [PubMed] [Google Scholar] 46. Майкл DJ, Валле Б., Кокс Дж., Калнс Дж. Э., Фогт Д.Л. Слюнные биомаркеры физической усталости как маркеры депривации сна. Журнал клинической медицины сна: JCSM: официальное издание Американской академии медицины сна. 2013; 9: 1325–31. [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Сёгнет Л., Боеро Дж., Готтшалк Л., Дантли С.П., Шоу П.Дж. Идентификация биомаркера влечения ко сну у мух и людей. Труды Национальной академии наук Соединенных Штатов Америки.2006; 103: 19913–8. [Бесплатная статья PMC] [PubMed] [Google Scholar] 48. Кранер-младший, Сигмон С.Т., Мартинсон А.А., МакГилликадди М.Л. Предменструальные расстройства и размышления. Журнал клинической психологии. 2014; 70: 32–47. [PubMed] [Google Scholar] 49. Ватанабе К., Сиракава Т. Характеристики воспринимаемого стресса и уровней секреторного иммуноглобулина А и кортизола в слюне у японских женщин с предменструальным синдромом. Обучение сестринскому и акушерскому делу. 2015; 4: e24795. [Бесплатная статья PMC] [PubMed] [Google Scholar] 50. Труба А.Ф., Мизрахи Д., Аучус Р.Дж., Фогель П.Д., Ритц Т.Влияние психосоциального стресса на характер высвобождения белка слюной. Физиология и поведение. 2012; 105: 841–9. [PubMed] [Google Scholar] 51. Идзава С., Сугая Н., Кимура К., Огава Н., Ямада К.С., Широтсуки К. и др. Повышение уровня интерлейкина-6 в слюне после острого психосоциального стресса и его биологические корреляты у здоровых молодых людей. Биологическая психология. 2013; 94: 249–54. [PubMed] [Google Scholar] 52. Джайлз Г.Е., Махони С.Р., Бруни Т.Т., Тейлор Х.А., Канарек РБ. Влияние стресса на настроение, ось HPA и вегетативную реакцию: сравнение трех парадигм психосоциального стресса.ПлоС один. 2014; 9: e113618. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53. Ледер Дж., Хауссер Дж. А., Мойзиш А. Стресс и принятие стратегических решений в игре конкурса красоты. Психонейроэндокринология. 2013; 38: 1503–11. [PubMed] [Google Scholar] 54. Наумова Е.А., Сандулеску Т., Бохниг С., Аль-Хатиб П., Ли В.К., Циммер С. и др. Динамические изменения слюны после острого психического стресса. Научные отчеты. 2014; 4: 4884. [Бесплатная статья PMC] [PubMed] [Google Scholar] 55. Вилла А, Абати С. Факторы риска и симптомы, связанные с ксеростомией: перекрестное исследование.Австралийский стоматологический журнал. 2011; 56: 290–5. [PubMed] [Google Scholar] 56. Sawair FA, Ryalat S, Shayyab M, Saku T. Нестимулированная скорость слюноотделения у здорового взрослого населения Иордании. Журнал исследований клинической медицины. 2009; 1: 219–25. [Бесплатная статья PMC] [PubMed] [Google Scholar] 57. Villa A, Polimeni A, Strohmenger L, Cicciu D, Gherlone E, Abati S. Собственные отчеты стоматологических пациентов о ксеростомии и связанных с ней факторах риска. Журнал Американской стоматологической ассоциации. 2011; 142: 811–6. [PubMed] [Google Scholar] 58.Мортазави Х., Бахарванд М., Мовахедиан А., Мохаммади М., Ходадустан А. Ксеростомия, вызванная системным заболеванием: обзор 20 состояний и механизмов. Летопись медицинских и медицинских исследований. 2014; 4: 503–10. [Бесплатная статья PMC] [PubMed] [Google Scholar] 59. Дэниэлс TE. Оценка, дифференциальная диагностика и лечение ксеростомии. Журнал ревматологии Дополнение. 2000; 61: 6–10. [PubMed] [Google Scholar] 60. Гупта А., Эпштейн Дж. Б., Срусси Х. Гипосаливация у пожилых пациентов. Журнал. 2006; 72: 841–6.[PubMed] [Google Scholar] 61. Салуджа П., Шетти В., Дэйв А., Арора М., Ханс В., Мадан А. Сравнительная оценка влияния менструации, беременности и менопаузы на скорость слюноотделения, pH и вкусовую функцию. Журнал клинико-диагностических исследований: JCDR. 2014; 8: ZC81–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Вирабхадраппа С.К., Чандраппа ПР, Патил С., Рудмал С.Ю., Кумарсвами А., Чаппи М.К. Оценка ксеростомии при различных психологических расстройствах: обсервационное исследование. Журнал клинико-диагностических исследований: JCDR.2016; 10: ZC24 – ZC7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 63. Сребный Л.М., Валдини А.Ю., Ксеростомия Ю.А. Часть II: Связь с неоральными симптомами, лекарствами и заболеваниями. Хирургия полости рта, стоматология и патология полости рта. 1989. 68: 419–27. [PubMed] [Google Scholar] 64. Rad M, Kakoie S, Niliye Brojeni F, Pourdamghan N. Влияние длительного курения на скорость слюноотделения и здоровье полости рта. Журнал стоматологических исследований, стоматологических клиник, стоматологических перспектив. 2010; 4: 110–4. [Бесплатная статья PMC] [PubMed] [Google Scholar] 65.Томсон WM, Чалмерс JM, Спенсер AJ, Slade GD. Лекарства и сухость во рту: результаты когортного исследования пожилых людей. Журнал государственной стоматологии. 2000; 60: 12–20. [PubMed] [Google Scholar] 66. Пун Р., Су Н, Чинг В., Дарлинг М., Грушка М. Снижение нестимулированной скорости слюноотделения при синдроме жжения во рту. Британский стоматологический журнал. 2014; 217: Е14. [PubMed] [Google Scholar] 67. Фарси НМ. Признаки сухости во рту в зависимости от скорости потока слюны, pH, буферной способности и жалоб на сухость во рту. BMC здоровье полости рта.2007; 7:15. [Бесплатная статья PMC] [PubMed] [Google Scholar] 68. Фенол-Паломарес С., Муньос-Монтагуд Дж., Санчиз В., Эррерос Б., Эрнандес В., Мингес М. и др. Нестимулированный расход слюны, pH и буферная способность слюны у здоровых добровольцев. Revista espanola de enfermedades digestivas. 2004. 96: 773–83. [PubMed] [Google Scholar] 69. Аладжбег И., Фалькао Д.П., Тран С.Д., Мартин-Гранизо Р., Лафори Г.И., Матранга Д. и др. Интраоральный электростимулятор для снятия ксеростомии: долгосрочное, многоцентровое, открытое, неконтролируемое, клиническое испытание.Хирургия полости рта, стоматология, патология полости рта и радиология полости рта. 2012; 113: 773–81. [PubMed] [Google Scholar] 70. van der Putten GJ, Brand HS, Schols JM, de Baat C. Диагностическая пригодность опросника по ксеростомии и связь между ксеростомией, гипосаливацией и использованием лекарств в группе жителей дома престарелых. Клинические оральные исследования. 2011; 15: 185–92. [Бесплатная статья PMC] [PubMed] [Google Scholar] 71. Корабль JA. Диагностика, лечение и профилактика заболеваний слюнных желез. Заболевания полости рта.2002; 8: 77–89. [PubMed] [Google Scholar] 72. Бхаттарай К.Р., Джунджаппа Р., Хандигунд М., Ким Г.-Р., Чае Х.-Дж. Отпечаток слюнной секреции при аутоиммунных нарушениях и связанных с ними патологических состояниях. Обзоры аутоиммунитета. 2018; 17: 376–390. [PubMed] [Google Scholar] 73. Эразмус К.Э., Ван Хюльст К., Ван Ден Хуген Ф.Дж., Ван Лимбек Дж., Ролевельд Н., Вирман Е.К. и другие. Загустение слюны после эффективного управления слюнотечением с помощью ботулинического токсина A. Медицина развития и детская неврология. 2010; 52: e114–8. [PubMed] [Google Scholar] 74.Lensen CM, Moons CP, Diederich C. Отбор проб слюны у собак: как выбрать наиболее подходящую процедуру для вашего исследования. Журнал ветеринарного поведения: клиническое применение и исследования. 2015; 10: 504–12. [Google Scholar] 75. Ghezzi EM, Lange LA, Ship JA. Определение вариации стимулированного слюноотделения. Журнал стоматологических исследований. 2000; 79: 1874–8. [PubMed] [Google Scholar] 76. Уолш Н. П., Монтегю Дж. С., Каллоу Н., Роулендс А. В.. Скорость потока слюны, концентрация общего белка и осмоляльность как потенциальные маркеры состояния гидратации всего тела во время прогрессирующего острого обезвоживания у людей.Архив устной биологии. 2004. 49: 149–54. [PubMed] [Google Scholar] 77. Вагнер Б.Д., Accurso FJ, Лагуна Т.А. Применимость креатинина мочи в качестве метода нормализации образцов у пациентов с муковисцидозом. Журнал муковисцидоза: официальный журнал Европейского общества муковисцидоза. 2010; 9: 212–6. [Бесплатная статья PMC] [PubMed] [Google Scholar] 78. Goodson JM, Kantarci A, Hartman ML, Denis GV, Stephens D, Hasturk H. et al. Риск метаболических заболеваний у детей по анализу биомаркеров слюны.ПлоС один. 2014; 9: e98799. [Бесплатная статья PMC] [PubMed] [Google Scholar] 79. Ли Дж.Й., Чанг Дж.В., Ким Ю.К., Чунг С.К., Хо Х.С. Сравнение состава остаточной слюны слизистой оболочки полости рта и цельной слюны. Заболевания полости рта. 2007; 13: 550–4. [PubMed] [Google Scholar] 80. Айенгар А., Паулюс Дж. К., Герлан Диджей, Марон Дж. Л.. Обнаружение и потенциальная полезность C-реактивного белка в слюне новорожденных. Границы педиатрии. 2014; 2: 131. [Бесплатная статья PMC] [PubMed] [Google Scholar] 81. Дауэс С. Циркадные ритмы скорости потока и состава нестимулированной и стимулированной подчелюстной слюны человека.Журнал физиологии. 1975. 244: 535–48. [Бесплатная статья PMC] [PubMed] [Google Scholar] 82. Свенсон Л.И. Прогресс в исследовании онкомаркеров. 2007; 2007. С. 17–41. [Google Scholar] 83. Халперн Т. Т., Уитсел Е. А., Вагнер Б., Харрис К. М.. Проблемы измерения суточной концентрации кортизола в крупном популяционном полевом исследовании. Психонейроэндокринология. 2012; 37: 499–508. [Бесплатная статья PMC] [PubMed] [Google Scholar]

84. ClinicalTrials.gov. Оценка слюны у здоровых добровольцев. 2017.

85.Salimetrics L. Сбор и обработка слюны. 2011; 2 (2-е издание): 1-11.

86. Такаги К., Исикура Ю., Хирамацу М., Накамура К., Дегава М. Разработка устройства для сбора слюны для использования в полевых условиях. Clinica chimica acta; международный журнал клинической химии. 2013; 425: 181–5. [PubMed] [Google Scholar] 88. Джусти Л., Бальдини С., Сирегия Ф., Джанначчини Дж., Джакомелли С., Де Фео Ф. и др. Является ли GRP78 / BiP потенциальным биомаркером слюны у пациентов с ревматоидным артритом? Протеомика Клинические приложения.2010; 4: 315–24. [PubMed] [Google Scholar] 89. Fabian TK, Fejerdy P, Nguyen MT, Soti C, Csermely P. Потенциальные иммунологические функции Hsp70 слюны в защитных механизмах слизистой оболочки и пародонта. Archivummunologiae et therapiae experimentalis. 2007; 55: 91–8. [PubMed] [Google Scholar] 90. Шерман Г.Г., Лилиан Р.Р., Кувадия А.Х. Тесты ротовой жидкости для скрининга младенцев, подвергшихся воздействию вируса иммунодефицита человека. Журнал детских инфекционных болезней. 2010; 29: 169–72. [PubMed] [Google Scholar] 92. Ага-Хоссейни Ф, Мирзайи-Дизга I, Рахими А., Сейланян-Туси М.Корреляция уровней CA125 в сыворотке и слюне у пациентов с раком груди. Журнал современной стоматологической практики. 2009; 10: E001–8. [PubMed] [Google Scholar]

инструментов для Drools | Журнал The Scientist Magazine®

Исследователи исследуют слюну на наличие генов, микроРНК и белковых маркеров, связанных с широким спектром заболеваний.

Хотя слюну легче и дешевле собирать, хранить и транспортировать, чем кровь, исследования жидкости и разработка новых диагностических средств на основе слюны и полости рта не всегда просты.При планировании интересующего аналита следует принимать во внимание множество инструментов для сбора, которые сейчас коммерчески доступны, а также подходящие стратегии обработки, стабилизации и замораживания. Эти факторы могут повлиять на ваши результаты, особенно если вы стремитесь к количественной оценке.

Ученый рассказал экспертам по слюне об их трюках. Вот что они нам сказали.

ВИДЫ ОБРАЗЦОВ
Слюна всего рта. Это слюнная жидкость и все дополнительные вещества: клетки изо рта, носовая слизь, кровь из крошечных язв во рту или деснах, микробиота и остатки пищи.Его собирают путем сплевывания или слюни в трубочку. Чтобы увеличить выход, вы можете стимулировать выработку слюны механически, пережевывая что-нибудь, что не мешает анализу, например, жевательную резинку, воск или силиконовую трубку. Еще больше слюны образуется при добавлении лимонной кислоты в жевательную резинку, жидкости для полоскания рта или конфеты.

Транссудат слизистой оболочки и жидкость десневой щели. Эти жидкости попадают в слюну, но, как правило, лучше отражают составные части крови, чем слюна всей ротовой полости, - говорит Дэниел Маламуд, профессор фундаментальных наук и черепно-лицевой биологии и директор программы исследований ВИЧ / СПИДа Стоматологического колледжа Нью-Йоркского университета. .Кроме того, жидкости являются хорошим источником антител IgG, количество которых во рту ограничено. Например, одобренный FDA экспресс-тест на антитела к ВИЧ-1/2 OraQuick ADVANCE собирает антитела в транссудате слизистой оболочки - ультрафильтрате крови, который проходит через поверхность слизистой оболочки щеки и неба. , впитывающая прокладка. Жидкость десневой щели содержится в щели между зубом и десной. «Вы можете собрать эту жидкость на бумажном штифте», - говорит Маламуд.«Хотя это всего несколько микролитров, люди могут проводить биохимию».

ЧТО МОЖНО АНАЛИЗИРОВАТЬ?
ДНК. Характеристика ДНК, обнаруженной в эпителиальных клетках и лейкоцитах, присутствующих в слюне, является одной из наиболее активных областей исследования слюны. Исследователи исследуют слюну на наличие генов, связанных с муковисцидозом, аутизмом и другими заболеваниями. По словам Слоуи, Oasis Diagnostics, например, проверила устройство для сбора ДНК • SAL для исследования различных генетических заболеваний и предрасположенностей, таких как болезнь Гоше, талассемия и сердечно-сосудистые заболевания.

© DORLING KINDERSLEY / GETTY IMAGES

Многие компании, продающие инструменты для сбора, также предлагают наборы для экстракции, адаптированные для консервированных образцов слюны (см. Ниже). Протокол извлечения ДНК из слюны для анализа с секвенированием следующего поколения доступен в журнале Journal of Visualized Experiments (doi: 10.3791 / 51697, 2014).

Хотя оценки различаются, примерно 30 процентов ДНК в цельной слюне происходит от бактерий во рту. New England BioLabs предлагает набор для усиления микробной ДНК (NEBNext Microbiome DNA Enrichment Kit) в образцах, собранных для исследований микробиома полости рта.

РНК. РНК обещает помочь не только в заболеваниях полости рта. Дэвид Вонг и его команда из Калифорнийского университета в Лос-Анджелесе извлекли внеклеточную РНК из слюны, связывая некоторые из этих РНК с наличием рака полости рта и других видов рака. Метод Вонга для профилирования микроРНК слюны, типа некодирующей РНК в бесклеточной слюне, доступен в Methods Mol Biol , 936: 313-24, 2013. Вонг разработал инструмент сбора (для нуклеиновых кислот и белков) под названием RNAPro • SAL, который продается компанией Oasis Diagnostics.Он работает путем сжатия абсорбирующей подушки, пропитанной специальной средой, для удаления клеток и другого мусора из образца. Другие исследователи разработали методы выделения РНК из клеток, присутствующих в слюне ( Clin Chem , 59: 1118-22, 2013).

Большая часть РНК в слюне поступает из микробов во рту. Исследование, проведенное группой Вонга, показало, что дополнительный этап низкоскоростного центрифугирования и увеличение глубины секвенирования помогает минимизировать влияние микробной РНК ( Clin Chem , 58: 1314-21, 2012).

Пептиды и белки. Около 30 процентов белков крови также присутствуют в слюне. В список входят цитокины, гормоны, факторы роста и антитела. Исследователи оценивают белки слюны как потенциальные маркеры системного воспаления, болезни Альцгеймера и диабета. Белки, наряду с РНК, особенно чувствительны к расщеплению ферментами и к различным методам сбора.

КАК ЕГО СОБИРАТЬ?
Универсального метода сбора слюны не существует; это зависит в первую очередь от возраста участника и ваших планов на анализ.Но способ сбора слюны, место отбора пробы во рту и время суток могут иметь значение. «Если есть различия в сборе [и обработке], будет сложно сравнивать результаты в разных лабораториях», - говорит Вонг. «Это особенно важно, если вы изучаете биомаркеры, которые, как вы надеетесь, будут клинически полезными», - добавляет он.

Пассивное слюноотделение (когда участник позволяет слюне собираться на дне рта, затем наклоняется вперед и капает в трубку) считается золотым стандартом методов сбора различных аналитов.Однако это требует соблюдения пациентом режима лечения и может быть затруднено даже для некоторых взрослых.

Исследователи, чьи объекты исследования - недоношенные и новорожденные дети, собирают слюну путем отсасывания - обычная процедура для неонатологов, но эта процедура становится все более доступной для других исследователей-клиницистов с разработкой Pedia • SAL, устройства, которое подключается к соске, но не «Для работы младенец не требует отсасывания», - говорит Джилл Марон, доцент Медицинской школы Университета Тафтса.Для младенцев старшего возраста и детей ясельного возраста Salimetrics предлагает инструменты для сбора, которые работают даже тогда, когда участники не сотрудничают.

Многие инструменты для сбора работают путем впитывания слюны. Крайне важно выяснить, одобрен ли данный инструмент для интересующей вас молекулы. «Мы знаем, что когда вы поглощаете образец слюны через какой-либо продукт из пены или хлопка, вы изменяете целостность этого образца способами, которые могут быть известны или неизвестны. В зависимости от того, что вас интересует в тестировании, вы можете или не сможете использовать этот образец », - говорит Дуглас Грейнджер, директор Института междисциплинарных биологических исследований слюны при Университете штата Аризона и основатель Salimetrics.

Например, в исследовании 2013 года исследователи сравнили белковые профили слюны, собранной с использованием пассивной слюны, парафиновой жевательной резинки или имеющегося в продаже ватного тампона. Общие концентрации белка, полученные исследователями во всех образцах, были одинаковыми; однако сами профили белков были несколько отличными, особенно профиль слюны, собранной с помощью мазка ( Clin Chim Acta , 419: 42-46). Лучше всего тщательно выбирать коммерческое устройство для сбора данных и поддерживать единообразие методов сбора во всех многоцентровых исследованиях.

КАК УЛУЧШИТЬ СБОР?
Метод пассивного слюноотделения обычно дает достаточно пробы, но если вам нужно стимулировать отток слюны, недавнее исследование мясоедов показывает, что запах бекона, приготовленного в микроволновой печи, усиливает отток слюны, не влияя на концентрацию гормонов ( Clin Ther , 37: 515 -22, 2015).

Помимо запаха бекона, есть леденцы, жидкости для полоскания рта и жевательные резинки, которые вы можете использовать, если вам нужно стимулировать выработку слюны. Убедитесь, что вы установили, что метод, который вы хотите использовать для стимуляции слюноотделения, не влияет на вашу способность определять интересующий вас аналит.Например, полоскание рта разбавит ваш образец, говорит Маламуд.

Кроме того, имейте в виду: «Есть разница между нестимулированной слюной, когда ее просто выплевывают в чашку или собирают с помощью такого инструмента, как наш, и стимулированной слюной», - говорит Слоуи. Изменение скорости потока может изменить концентрацию одних аналитов больше, чем других.

КАК ВЫ УЧИТЫВАЕТЕ РАЗНИЦЫ В СТОИМОСТИ ПОТОКА?
Помимо стимуляции слюноотделения, на скорость слюноотделения влияет множество различных факторов (например, возраст, физические упражнения, курение, употребление алкоголя, время дня и общее состояние полости рта).Учет различий в скорости слюноотделения у людей может быть важен при сборе количественных данных. Некоторые исследователи непосредственно измеряют скорость потока слюны человека: объем собранной слюны (измеренный с помощью пипетки), деленный на время, необходимое для ее образования.

Другой способ обойти разницу в расходах - использовать устройство, предназначенное для сбора фиксированного количества жидкости. Вивек Шетти из Калифорнийского университета в Лос-Анджелесе и его сотрудники разработали такое устройство, которое собирает 100 мкл, и продают его через японскую компанию Nanbu Irika по цене 10 долларов за устройство (или 280 долларов за 30 устройств).

Внутренний контроль также важен, когда вы корректируете разницу в скорости потока или различия в качестве пробы. Концентрация общего белка - это один из подходов; небольшая панель маркеров РНК - другая. Проверьте, измерял ли кто-нибудь интересующий вас аналит и есть ли какие-либо проверенные ссылки.

КАК ЕГО СОХРАНИТЬ?
Слюна содержит ферменты, которые могут быстро разлагать аналит. Некоторые аналиты, такие как кортизол или мелатонин, более стабильны при комнатной температуре, чем другие.Но в целом, по словам Слоуи, рекомендуется охладить слюну в холодильнике сразу после сбора и «очистить» ее перед замораживанием.

Детали очистки частично зависят от того, находится ли ваша молекула внутри клетки или за ее пределами, но для любого варианта доступны коммерческие наборы для экстракции. Что касается внеклеточных РНК, исследователи вращают клетки и анализируют или замораживают только супернатант. С другой стороны, исследователи, изучающие ДНК человека, используют гранулы клеток, лизируя их и используя спин-колонки, которые связывают геномную ДНК и позволяют смыть остатки.

Стабилизирующие буферы (продаваемые Norgen, Qiagen и другими) помогают нейтрализовать ферменты, которые могут разрушать ДНК и РНК. Если вы не можете сразу положить образцы в морозильную камеру, тогда вам могут помочь эти реагенты (например, RNAprotect Saliva Reagent от Qiagen). Семейство наборов Oragene компании DNA Genotek для сбора ДНК и РНК человека в слюне содержит консерванты, которые позволяют исследователям хранить образцы при комнатной температуре.

Для тех исследователей, которые интересуются микробной ДНК и РНК, наборы OMNIgene Discover компании DNA Genotek для микробной ДНК и РНК (OM-505) или только ДНК (OM-501) также идеально подходят для длительного хранения, отмечает Дэвид Спайчер, исследователь из Griffith. Университет Квинсленда, Австралия, изучавший методы добычи и хранения.

Белки являются наиболее лабильными из всех аналитов, а растворы, стабилизирующие ДНК и РНК, многие из которых действуют путем ингибирования ферментов, не помогают сохранить белки. По словам Спайхера, это активная область работы. Чтобы решить проблему с белком, группа Вонга разработала стабилизирующий раствор, который предварительно добавляют в пробирки для сбора RNAPro • SAL ( Anal Chim Acta , 722: 63-69, 2012).

НА СКОЛЬКО МОЖНО ЕГО ЗАМОРОЗИТЬ?
Морозильник до –80 ° C может сохранять слюну в течение длительного времени, но для данного аналита пределы не проверены.Недавние данные Speicher указывают на предостережение: ДНК слюны без стабилизирующего раствора, хранящаяся при -80 ° в течение 14 месяцев без циклов замораживания-оттаивания, частично или полностью разрушается ( Diagn Microbiol Infect Dis , 82: 120-27 , 2015).

Как правило, делите образцы на аликвоты, чтобы минимизировать циклы замораживания-оттаивания. «Мы всегда рекомендуем хранить образцы в холодном состоянии после того, как они собраны, и чтобы холодовая цепь контролировалась очень тщательно, пока они не могут быть заморожены», - говорит Грейнджер.

И если после прочтения множества доступных сейчас обзоров по сбору и обработке слюны вы все еще заблудились, тогда возьмите телефон и позвоните кому-нибудь, кто делал то, что вы стремитесь сделать. «Большинство ученых более чем счастливы поговорить», - говорит Маламуд.

Недорогое средство измерения здоровья

Слюна отражает состояние здоровья или болезни человека. Кроме того, для сбора требуется минимальное оборудование, сбор неинвазивный, а хранение сравнительно недорогое.Кроме того, поскольку слюна не стерильна, она не подвержена такому же риску микробного заражения, которое влияет на качество пробы. Тем не менее, метод сбора, время и объем - все это важные факторы, влияющие на процесс сбора. Таким образом, Rosa et al. (2016) установили стандартные рабочие процедуры для определения характеристик слюны при хранении. 1

Авторы собрали 22 образца слюны у здоровых добровольцев. Они попросили добровольцев воздержаться от еды, питья и выполнения процедур гигиены полости рта в течение одного часа до сбора слюны.Непосредственно перед забором добровольцы полоскали рот чистой водой в течение 30 секунд, чтобы удалить слущенные эпителиальные клетки, микроорганизмы и остатки пищи и напитков. Через минуту авторы использовали один из трех методов сбора:

  1. Пассивное слюноотделение: авторы использовали стерильную пробирку на 50 мл для сбора пассивной слюны в течение трех минут.
  2. Сублингвальный ватный валик: они поместили ватный валик под язык на две минуты, а затем поместили валики в 15-метровую стерильную пластиковую пробирку со стерильным наконечником пипетки на 100 мл на дно, чтобы облегчить сбор слюны центрифугированием при 10000 g в течение 10 минут при 4ºC.
  3. Вестибулярный ватный валик: исследователи выполнили ту же процедуру, что и для подъязычного валика, но поместили ватный валик в вестибулярную область рта.

Исследователи также оценили внутриличностную изменчивость путем сбора дополнительных образцов от восьми здоровых доноров в 11 разное время в течение пяти месяцев.

Что касается объема, Rosa et al. обнаружили, что методом сбора, который дает наибольшую объемную концентрацию белка, был сублингвальный метод.Они также обнаружили, что время суток влияет на количество собираемой слюны, а днем ​​ее становится меньше. Гель-электрофорез показал, что существуют белки, которые различаются у разных людей, хотя все люди считаются здоровыми. Они идентифицировали в общей сложности 19 групп белков с молекулярной массой от 9,2 кДа до 157,6 кДа. Они идентифицировали 5 из них, которые присутствовали у всех людей. Используя капиллярный электрофорез, они обнаружили, что разложение белка при комнатной температуре не было значительным в течение первых 24 часов после сбора.

Rosa et al. продемонстрировали, что можно получить образцы слюны, подходящие для хранения биобанка, простым и недорогим методом.

Номер ссылки

Rosa, N., et al. (2016) «Оценка качества белка в образцах слюны для целей биобанкинга», Биоконсервация и биобанкинг [Epub перед печатью].

Поделиться статьей

На профили микробиома слюны минимально влияет метод сбора или протоколы выделения ДНК.

Когорта исследования и сбор образцов

Это исследование было одобрено Технологическим университетом Квинсленда (HREC no.: 1400000617) Совет медицинского этического учреждения и информированное согласие было получено от всех участников. Все методы в этом исследовании были выполнены в соответствии с соответствующими руководящими принципами и правилами. Мы набрали нормальных здоровых контролей (n = 40) из общей популяции на основе строгих критериев набора (дополнительные данные 1), чтобы минимизировать базовые вариации, которые могут потенциально повлиять на экспериментальные конечные точки. Все добровольцы (в возрасте от 20 до 30 лет) отметили, что у них хорошее общее состояние здоровья, отсутствуют какие-либо сопутствующие заболевания, они не получали антибиотики местного и / или системного действия и не курили и не употребляли алкоголь.

Добровольцев попросили воздержаться от еды и питья в течение часа перед сдачей образцов слюны, как в нашей предыдущей работе 9, 10, 12 . Добровольцев попросили сесть в удобном положении и прополоскать рот бутилированной водой, чтобы удалить остатки пищи. Набор из двух образцов слюны слюны был взят у десяти добровольцев (всего образцов, n = 20) в стерильную пробирку Falcon объемом 50 мл (Becton, Dickinson and Company, Нью-Джерси, США) и пробирку OMNIgene (DNA Genotek Incorporation, Онтарио, США). Канада) соответственно.Образцы слюны были собраны, когда добровольцев просили с силой выплюнуть слюну (не мокроту) непосредственно в устройства для сбора слюны (OMNIgene включает в себя отдельный мундштук, который можно подключить к устройству для слюноотделения и слюноотделения) (рис. 1а). OMNIgene содержал 1 мл стабилизирующего буфера, поэтому максимальный образец слюны, который можно собрать, составляет 1 мл (емкость пробирки OMNIgene составляет 2 мл). Поскольку для экстракции требуется 200 мкл образца слюны, для получения аналогичных объемов образцов слюны для микробного анализа использовали смесь 1: 1 образца слюны, взятого из стерильной пробирки Falcon объемом 50 мл, и 1 х фосфатно-солевой буфер (PBS).

Рис. 1

Обзор дизайна исследования. Из рис. 1а было обнаружено, что набор для крови Maxwell® 16 LEV является наиболее эффективным методом выделения бактериальной гДНК, когда образцы слюны собирали в стерильную пробирку Falcon объемом 50 мл. Следовательно, OMNIgene и другие методы выделения бактериальной гДНК из слюны были исключены из второй части исследования (рис. 1b).

Аналогичным образом три набора фракций слюны были собраны у разных когорт из 30 нормальных здоровых добровольцев (всего пробы, n = 90) в порядке слюны, слюны и полоскания рта с пятиминутными интервалами.Образцы слюны собирали, прося добровольцев собрать слюну во рту и отхаркивать естественным путем в стерильную пробирку Falcon объемом 50 мл, в то время как образцы слюны собирали, как описано выше. Образцы для полоскания рта собирали, прося добровольцев прополоскать горло 10 мл 0,9% (мас. / Об.) Физиологического раствора (Baxter International Incorporate, Иллинойс, США) в течение минуты и сплевать в стерильную пробирку Falcon объемом 50 мл, как было опубликовано ранее ( Рис. 1б) 8 . Мы также проверили обратный порядок сбора образцов, чтобы убедиться, что порядок сбора не влияет на микробное разнообразие.

После сбора все образцы были доставлены обратно в лабораторию на сухом льду. Образцы слюны и слюны равномерно помещали в пробирки Эппендорфа объемом 1,5 мл (Eppendorf, Гамбург, Германия) и хранили при -80 ° C. Образцы для полоскания рта дополнительно обрабатывали центрифугированием при 1000 × g в течение 15 минут при 4 ° C для отделения клеточного осадка от бесклеточного супернатанта слюны. Клеточные осадки ресуспендировали в стерильном 1 x PBS, равномерно распределяли аликвоты в пробирки Эппендорфа на 1,5 мл и хранили при -80 ° C.

Набор для ДНК крови Maxwell® 16 LEV

Образцы слюны (200 мкл независимо от фракции) подвергали центрифугированию при 16000 × g в течение 10 минут при 4 ° C (для снижения бактериальной активности в образцах слюны) для отделения клеточного осадка. из бесклеточного супернатанта. К клеточному осадку добавляли 500 мкл собственного буфера для лизиса (200 мл 0,5 М хлорида натрия, 0,05 М трисаминометана при pH 8, 0,05 М этилендиаминтетрауксусной кислоты и 4% додецилсульфата натрия) и тщательно перемешивали встряхивание.Затем образцы переносили в микропробирку с конической завинчивающейся крышкой объемом 2 мл с цирконимовыми шариками (комбинация 0,3 г 0,1 мм и 0,1 г 0,5 мм, Daintree Scientific, Сент-Хеленс, Тасмания, Австралия), и клетки разрушали с помощью Precellys. ® 24 (Bertin Corporation, Роквилл, США) при 5000 × g в течение 3 × 60 секунд. Затем гомогенаты инкубировали на водяной бане при 70 ° C в течение 15 минут, при этом содержимое перемешивалось с пятиминутными интервалами путем осторожного переворачивания пробирок. После инкубации образцы центрифугировали при 15000 × g в течение пяти минут и фракции супернатанта переносили в стерильный 1.Пробирки Эппендорфа объемом 5 мл, содержащие 30 мкл протеиназы-К (набор для ДНК крови Maxwell® 16 LEV), встряхивали в течение 30 секунд, затем инкубировали при 56 ° C в течение 20 минут. Затем из этих образцов выделяли общие нуклеиновые кислоты с использованием колонок ДНК крови с использованием Maxwell® 16 MDx Research Instrument (Promega Corporation, Висконсин, США). Наконец, к образцам добавляли 2 мкл 10 мкг РНКазы A (Qiagen, Hilden, Германия) и инкубировали на водяной бане при 37 ° C в течение 15 минут для расщепления РНК.

Фенол-хлороформный метод

Подготовка образцов и лизис бактериальных клеток для фенол-хлороформного метода экстракции были аналогичны методу ДНК крови Maxwell® 16 LEV, описанному выше, со следующими модификациями.После второй инкубации на водяной бане при 56 ° C в течение 20 минут добавляли равные объемы насыщенного буфером фенола (Sigma Co., Виктория, Австралия), перемешивали путем переворачивания несколько раз и центрифугировали при 18000 × g в течение 5 минут при 4. ° C. Водный слой осторожно удаляли в новую пробирку Эппендорфа объемом 1,5 мл, не нарушая межфазный слой. Равный объем смеси хлороформ: изоамиловый (24: 1) спирт (Sigma Co., Виктория, Австралия) добавляли к образцу и встряхивали в течение 5 минут для дальнейшей очистки.Смешанные образцы центрифугировали при 18000 × g в течение 10 минут при 4 ° C, и водный слой переносили в новую пробирку Эппендорфа на 1,5 мл. В зависимости от объема водного слоя к образцу добавляли 1:10 3 М ацетата натрия (pH 5,2) и равный объем 100% изопропанола и тщательно перемешивали перед инкубацией при -20 ° C в течение ночи. Затем образцы центрифугировали при 18000 × g в течение 10 минут при 4 ° C, супернатант удаляли и к осадку добавляли 500 мкл 70% этанола перед повторным центрифугированием при 18000 × g в течение 5 минут при 4 ° C.Супернатант отбрасывали, а образцы гДНК сушили с использованием концентратора SpeedVac SAVANT ISS110 (ThermoFisher Scientific, Массачусетс, США) в течение 5 минут при 60 ° C. ГДНК ресуспендировали в 20 мкл 1 × буфера трисаминометана и этилендиаминтетрауксусной кислоты и встряхивали в течение минуты для хорошего перемешивания. Наконец, к образцу добавляли 2 мкл 10 мкг РНКазы A и инкубировали на водяной бане при 37 ° C в течение 15 минут для расщепления РНК.

QIAamp DNA Microbiome Kit

Подготовка образцов и лизис бактериальных клеток для метода экстракции QIAamp DNA Microbiome Kit (Qiagen, Hilden, Германия) были аналогичны методу ДНК крови Maxwell® 16 LEV.Однако протеиназу К из набора микробиома ДНК QIAamp использовали для второй инкубации. Экстракцию набора микробиома ДНК QIAamp проводили в соответствии с инструкциями производителя, и гДНК элюировали в конечном объеме 50 мкл. К образцу гДНК добавляли 2 мкл 10 мкг РНКазы и инкубировали на водяной бане при 37 ° C в течение 15 минут для расщепления РНК.

Количественное определение гДНК

Количество и качество экстрагированной гДНК оценивали с использованием спектрофотометра Nano Drop ND-1000 (ThermoFisher Scientific, Массачусетс, США).

Количественная ПЦР

Набор праймеров бактериальной 16S рРНК (1114F-5 'CGGCAACGAGCGCAACCC 3' и 1221R-5 'CCATTGTAGCACGTGTGTAGCC 3') и набор праймеров для β-глобина 923ATCAC3 и RTCACTC3 человека CAACTTCTC3 (F-5 ′ GAAGAGCCAAGGACAGGTAC 3 ') использовали в количественных (q) реакциях ПЦР для определения соотношения бактерий и гДНК человека из экстрагированных образцов. Реакция включала 5 мкл 2 × iTaq ™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, Калифорния, США), 200 нМ прямого и обратного праймеров для каждого из соответствующих генов и 20 нг матрицы гДНК.Общий реакционный объем (10 мкл) подвергали амплификации кПЦР в условиях начальной стадии денатурирования при 95 ° C в течение 10 минут с последующими 30 циклами в минуту при 60 ° C. Escherichia coli гДНК использовали в качестве положительного контроля, а воду ДНКазы / РНКазы использовали в качестве отрицательного контроля для анализа qPCR.

Подготовка и секвенирование библиотеки ампликонов гена 16S рРНК

Ампликоны гена 16S рРНК для секвенирования с помощью системы Illumina MiSeq (Illumina Incorporate, Калифорния, США) были получены в соответствии с методом производителей со специфическими для генов последовательностями, нацеленными на гипервариабельные области V6 и V8 гена 16S рРНК 23 .Фермент полимеразы Q5® Hot Start High-Fidelity (New England Biolads, Masachusetts, США) был использован для индексной ПЦР вместо рекомендованного фермента полимеразы KAPA HiFi HotStart ReadyMix (Kapa Biosystem, Массачусетс, США), поскольку предыдущий фермент давал превосходную амплификацию. эффективность с меньшим количеством ошибок. Секвенирование проводили в Австралийском центре экогеномики (ACE, Брисбен, Австралия).

Статистический анализ

Статистический анализ для исследования влияния устройств для сбора слюны и эффективности методов выделения гДНК слюны проводился с использованием GraphPad Prism (GraphPad Software Incorporate, Калифорния, США).Поскольку количество и качество извлеченной гДНК не имели нормального распределения, непараметрический критерий ранжирования согласованных пар Уилкоксона со знаком ранжирования использовался при сравнении двух различных переменных, тогда как критерий Фридмана использовался при сравнении более чем двух различных переменных. Кроме того, тест Фридмана также использовался для анализа средней вариации Ct бактериального гена 16S рРНК и гена β-глобина человека из выделенной гДНК.

Секвенированные наборы данных Illumina были проанализированы с использованием версии 1 Quantitative Insights Into Microbial Ecology (QIIME).9.1 [PMID: 20383131] на виртуальной машине Ubuntu Linux (Canonical Limited, Лондон, Великобритания). USEARCH 6.1 [PMID: 20709691] использовался для выполнения обнаружения и удаления химер на основе эталонов, чтобы избежать воспринимаемого разнообразия 24 . Вкратце, последовательности были сгруппированы в рабочие таксономические единицы (OTU) с помощью PyNAST [PMID: 191] с 97% -ным порогом идентичности последовательностей по сравнению с базой данных основного набора Greengenes версии 13.8 [PMID: 16820507] 25 . Таблица OTU была создана со списком прокариот и их соответствующими наблюдаемыми подсчетами OTU (численностью) для каждого образца на основе секвенированных данных в формате матрицы биологических наблюдений.Таблица OTU была дополнительно отредактирована, чтобы удалить OTU с низким содержанием (≤0,1% от общего числа последовательностей) и любые последовательности, которые не имели бактериального или архейного происхождения. Таблица с субдискретизацией OTU была создана путем случайной выборки (без замены) исходной таблицы OTU на основе выборки с наименьшим количеством OTU для учета различной глубины секвенирования, которая может иметь место для каждой отдельной выборки. Подвыборочная таблица OTU использовалась для расчета показателей разнообразия α- (внутри выборки) и β- (между выборками) и для генерации сводок таксонов для каждой фракции слюны, от уровня классификации до уровня рода.Индекс Шеннона использовался в качестве оценки богатства и равномерности микробного сообщества. Расстояние между образцами было представлено взвешенными (количественными) и невзвешенными (качественными) метриками расстояния UniFrac [PMID: 16332807], которые представлены с помощью анализа главных компонент (PCoA). Calypso версии 5.4 (http://cgenome.net:8080/html/wiki/index.php/Calypso) использовался для дальнейшего анализа этих данных путем предоставления статистической информации о значимости распределения для каждого рода, а также для комбинированных родов в три фракции слюны.Поскольку распределение родов между каждой фракцией слюны непараметрическое, ранговый тест Краскела-Уоллиса использовался на Calypso для выявления любых значительных различий в распределении родов. Согласно полученным p-значениям, нет значительных различий в распределении родов при слюноотделении и полоскании рта (дополнительные данные 6).

Советы по предотвращению отклонения теста слюны на COVID-19

Обновление от 14 июня 2021 г .: Тестирование на COVID-19 в кампусе теперь проводится только с помощью мазка из носа.

Следующее сообщение было доставлено студентам и сотрудникам из канцелярии канцлера:

По мере того, как завершается первая неделя нового весеннего семестра тестирования, мы хотим поблагодарить вас за ваше терпение и преданность делу, которые помогли нам запустить новый процесс тестирования на COVID-19 на основе слюны. Команды в университете прилагают все усилия, чтобы подготовить все к началу занятий 25 января, и наш опыт на этой неделе будет и будет использоваться для улучшения наших процессов сбора.

Мы знаем, что многие из вас уже начали тестирование. Хотя большинство тестов удалось обработать и предоставить результаты, некоторым из вас сообщили, что ваш образец был отклонен. Мы знаем, что это может расстраивать, и предпринимаем шаги, чтобы избежать такого исхода.

Ниже мы собрали несколько предложений по повышению шансов на успешное прохождение теста, основанные на том, что мы видели на прошлой неделе. Пожалуйста, знайте, что ваше участие и готовность пройти тестирование сыграли решающую роль в наших усилиях по составлению этого списка.

Лаборатории нужна жидкая часть вашей слюны для успешного проведения теста. Ваша слюна должна быть прозрачной, без обесцвечивания, без пищи и слизи и не должна содержать остатков, например, от чистки зубов или курения.

За час до теста:

  • Не пить (включая воду)
  • Не ешь
  • Не чистите зубы зубной нитью и зубной нитью, не используйте жидкость для полоскания рта
  • Не жевать жвачку и не курить

Вы также можете прополоскать или прополоскать рот водой, чтобы удалить любые пятна (например, от кофе) или небольшие кусочки пищи.Обязательно сделайте это как минимум за час до теста.

На вашем тесте:

  • Следуйте этим советам, чтобы производить достаточное количество слюны.
  • Слейте слюни под язык.
  • Закройте лицо перед тем, как начать стекать слюни в воронку или трубку; заменить его между депозитами.
  • Проведите кончиком языка по деснам за зубами, чтобы стимулировать слюнные железы и поместить эту слюну в воронку.
  • Избегайте полоскания слюны во рту или вытягивания слюны из задней части рта.

Это наиболее частые причины, по которым образцы слюны отклоняются лабораторией:

  • Слишком много слюны (необходимо 1,0 - 1,5 мл жидкой слюны, не включая пузырьки, но не более)
  • Слишком мало слюны (менее 1,0 мл)
  • Изменение цвета
  • Видимые комки пищи, слизи или других остатков, например зубной пасты

Примечание. Пузырьки будут в воронке для слюны и в образце. Пока жидкость стекает на дно и у вас достаточно, все в порядке.Если вы заметили что-либо из этого, когда отправляете образец, попросите начать заново с новой пробиркой. Лучше повторить тест во время запланированного приема, чем делать это снова на следующий день.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *