21 зуб: Строение зуба человека, зубы верхней челюсти

Содержание

6520250202010 Пара коническая КАМАЗ-6520 среднего моста (комплект ) Z=35/21 зуб (5,11) (ОАО КАМАЗ) - 6520-2502020-10

6520250202010 Пара коническая КАМАЗ-6520 среднего моста (комплект ) Z=35/21 зуб (5,11) (ОАО КАМАЗ) - 6520-2502020-10 - фото, цена, описание, применимость. Купить в интернет-магазине AvtoAll.Ru Распечатать

21

1

Применяется: КАМАЗ

Артикул: 6520-2502020-10

Код для заказа: 144828

Есть в наличии Доступно для заказа - >10 шт.Сейчас в 4 магазинах - 8 шт.Цены в магазинах могут отличатьсяДанные обновлены: 19.03.2021 в 15:30 Доставка на таксиДоставка курьером - 150 ₽

Сможем доставить: Послезавтра (к 21 Марта)

Доставка курьером ПЭК - EasyWay - 150 ₽

Сможем доставить: Послезавтра (к 21 Марта)

Пункты самовывоза СДЭК Пункты самовывоза Boxberry Постаматы PickPoint Магазины-салоны Евросеть и Связной 
Терминалы ТК ПЭК - EasyWay Самовывоз со склада интернет-магазина на Кетчерской - бесплатно

Возможен: сегодня c 17:52

Самовывоз со склада интернет-магазина в Люберцах (Красная Горка) - бесплатно

Возможен: завтра c 17:00

Самовывоз со склада интернет-магазина в поселке Октябрьский - бесплатно

Возможен: завтра c 17:00

Самовывоз со склада интернет-магазина в Сабурово - бесплатно

Возможен: послезавтра c 19:00

Самовывоз со склада интернет-магазина на Братиславской - бесплатно

Возможен: завтра c 17:00

Самовывоз со склада интернет-магазина в Перово - бесплатно

Возможен: завтра c 17:00

Самовывоз со склада интернет-магазина в Кожухово - бесплатно

Возможен: послезавтра c 11:00

Самовывоз со склада интернет-магазина в Вешняков - бесплатно

Возможен: послезавтра c 11:00

Самовывоз со склада интернет-магазина из МКАД 6км (внутр) - бесплатно

Возможен: послезавтра c 11:00

Самовывоз со склада интернет-магазина в Подольске - бесплатно

Возможен: послезавтра c 11:00

Код для заказа
144828 Артикулы 6520-2502020-10 Производитель KAMAZ Доп. скидка по дисконтным картам не предоставляется Каталожная группа: ..Мост средний (промежуточный)
Трансмиссия
Ширина, м: 0.3 Высота, м: 0.3 Длина, м: 0.4 Вес, кг:
23

Отзывы о товаре

Где применяется

Сертификаты

Обзоры

Наличие товара на складах и в магазинах, а также цена товара указана на 19.03.2021 15:30.

Цены и наличие товара во всех магазинах и складах обновляются 1 раз в час. При достаточном количестве товара в нужном вам магазине вы можете купить его без предзаказа.

Интернет-цена - действительна при заказе на сайте или через оператора call-центра по телефону 8-800-600-69-66. При условии достаточного количества товара в момент заказа.

Цена в магазинах - розничная цена товара в торговых залах магазинов без предварительного заказа.

Срок перемещения товара с удаленного склада на склад интернет-магазина.

Представленные данные о запчастях на этой странице несут исключительно информационный характер.

815cac3b026de24e91fa91df74337c58

Добавление в корзину

Доступно для заказа:

Кратность для заказа:

Добавить

Отменить

Товар успешно добавлен в корзину

!

В вашей корзине на сумму

Закрыть

Оформить заказ

частная стоматологическая клиника в Москве. Стоматология по доступным ценам

Я, доктор Ланцет Дмитрий Гершевич, искренне рад приветствовать каждого посетителя сайта стоматологической клиники «Ланцет». Зашли ли вы к нам случайно, или воспользовались чьим-то советом - в любом случае вы встретите здесь индивидуальный и профессиональный подход, порядочное отношение к работе с пациентом, и уважение к миссии Врача в целом.


«Лучше заплатить врачу деньгами, чем здоровьем». За что мы платим стоматологам?

Не помню кто и когда сказал - «Лучше заплатить врачу деньгами, чем здоровьем»… Ведь МЕДИЦИНА, вот уже многие столетия, торгует этим весьма специфическим товаром, который называется здоровье, ну или надежда на здоровье, в крайнем случае. Вот и Мольер был того же мнения.
Как многое в нашей жизни, медицина разрывается между служением, миссией на Земле, клятвой Гиппократа, понятием о чести врача и… деньгами, презренными деньгами… без которых не может, как выяснилось, функционировать ни одно лечебное заведение и ни один храм науки. Это две руки от одного тела.

Я еще застал времена, когда врачу про деньги говорить было стыдно. За лечение всегда кто-то платит, не обязательно конечный потребитель. В большинстве стран – это посредник в лице страховой компании. А кто платит, тот и заказывает музыку.

Здоровье Ваше, а что с ним делать решает даже не лечащий врач. Впрочем, идеальной схемы придумать так никому и не удалось ни в одной стране Мира.

Так почему же в разных странах, городах и клиниках в одном городе так разняться цены на одни и те же услуги врачей? За что же платит пациент, приходя в лечебное заведение?

Возьмем стоматологию, она мне ближе и понятней. Платим мы не за коронку, пломбу или имплантат, а за ДОВЕРИЕ и КВАЛИФИКАЦИЮ. С точки зрения закона услуга врача и сапожника равны, как это ни смешно. Цена ошибки, правда, разная, очень разная.

Как сориентироваться, когда клиник много, а здоровье одно?

Есть, однако, и ориентиры. Среднерыночная цена услуги, которую легко выявить, не вставая со стула на сайтах клиник. Очень низкая цена гарантирует, что на Вашем здоровье будут вынуждены экономить. Материалы, инструменты, врачи, стерилизация, сервис. Видно это уже при входе по лицам. Высокая цена ничего не гарантирует, но допускает возможность качественного лечения.
Клиника должна быть легальной. С лицензией на нужное Вам лечение. Это говорит о том, что у нее есть возможность сделать свою работу хорошо.
Должен быть договор с Вами, как пациентом. Согласие на лечение, осмотр подтверждается всегда письменно. План лечения составляется до лечения и содержит сроки и цены. Вы его подписываете, если, конечно, согласны. Только после этого можно приступать. Согласие Ваше на лечение не влечет обязательности лечения. Если передумали, никто заставить Вас не может.

При внешнем осмотре должно быть визуально чисто. Грязно снаружи – грязно и внутри, люди то одни и те же.

Лоток с инструментами запечатан в стерильном, чаще всего бумажном пакете, вскрывается при пациенте. Та же история и с инструментами, которые понадобились по ходу работы. Все это хрустит при открывании и видно сразу.

И еще, может самое главное, интуиция – великий дар, слушайте свой внутренний голос и не ошибетесь.

С уважением,
доктор Дмитрий Гершевич Ланцет

Зубчатая гладилка из нержавеющей стали KUBALA зуб 130x480 мм, ручка G-21 0257 - цена, отзывы, характеристики, фото

Зубчатая гладилка из нержавеющей стали KUBALA зуб 130x480 мм, ручка G-21 0257 представляет собой удобный инструмент, при помощи которого можно выравнивать отделочные растворы.

Удобная рукоятка значительно облегчает удержание.

  • Габариты, мм 130х480
  • Длина лезвия, мм 480
  • Ширина полотна, мм 130
  • Зубцы есть
  • Материал рукояти двухкомпонентная
  • Материал полотна 480

Этот товар из подборок

Комплектация *

  • Гладилка;
  • Упаковка.

Параметры упакованного товара

Единица товара: Штука
Вес, кг: 0,73

Длина, мм: 130
Ширина, мм: 480
Высота, мм: 100

Произведено

  • Польша — родина бренда
  • Польша — страна производства*
  • Информация о производителе
* Производитель оставляет за собой право без уведомления дилера менять характеристики, внешний вид, комплектацию товара и место его производства.

Указанная информация не является публичной офертой

На данный момент для этого товара нет расходных материалов

Сервис от ВсеИнструменты.ру

Мы предлагаем уникальный сервис по обмену, возврату и ремонту товара!

Вернем вам деньги, если данный товар вышел из строя в течение 6 месяцев с момента покупки.

Обратиться по обмену, возврату или сдать инструмент в ремонт вы можете в любом магазине или ПВЗ ВсеИнструменты.ру.

Гарантия производителя

Гарантия производителя не распространяется

Как потерянный зуб может изменить форму вашего лица

Когда большинство людей думают об эстетических последствиях потери зубов в Creve Coeur, они думают только о том, как это создает пробелы в улыбке человека. Они могут не осознавать, что изменения также происходят ниже линии десен, которые также могут повлиять на эстетику лица. В этой записи блога мы обсудим эти изменения и то, как вы можете сохранить естественную форму лица.

Потеря зубов и коллапс лица

В некоторых отношениях кости, в том числе челюстная кость, похожи на мышцы.Если их не использовать регулярно, они начинают выходить из строя. Следовательно, когда челюстная кость больше не используется для поддержки зуба, тело начинает резорбировать его, в результате чего он становится меньше и слабее. Фактически, до 25 процентов кости, которая когда-то поддерживала зуб, может быть потеряно в течение первого года после удаления.

В конце концов, резорбция челюстной кости может достигнуть точки, когда лицо станет сморщенным и сморщенным. Чем больше зубов потерял человек, тем заметнее будут изменения формы лица.

Предотвращение коллапса лица

Традиционные варианты замены зубов, такие как зубные протезы и мостовидные протезы, могут восстановить жевательную способность и заполнить некрасивые пробелы в улыбке человека. Однако они заменяют только верхнюю часть зуба, ту часть, которая видна над линией десен. Они ничего не делают для замены корня зуба, который отвечает за сохранение прочности и здоровья челюстной кости. К счастью, есть способ заменить весь зуб и тем самым предотвратить коллапс лица: зубные имплантаты.

Что такое зубные имплантаты? В чем их преимущества?

Зубные имплантаты - это небольшие штифты из титанового сплава. Они хирургическим путем помещаются в челюсть и, таким образом, служат протезами корней зубов. Они фактически срастаются с костью вокруг себя, что означает, что они обеспечивают длительную поддержку челюсти и могут предотвратить рассасывание. Реставрации, такие как мосты, зубные протезы или коронки, устанавливаются поверх зубных имплантатов, чтобы заменить видимые части утраченных зубов.

Зубные имплантаты - это действительно комплексное решение для замены зубов.Помимо стимуляции челюсти, они также:

  • Имеют потенциал прослужить всю жизнь
  • Простота ухода за
  • Выглядит совершенно естественно
  • Позвольте вам есть практически все
  • Успешность превышает 95%

Если вы недавно потеряли зуб, вам следует как можно скорее поговорить со своим стоматологом о зубных имплантатах в Creve Coeur. Ожидание только ухудшит резорбцию вашей кости, что увеличивает вероятность того, что вам потребуется костный трансплантат, прежде чем вы получите право на зубные имплантаты.

Коллапс лица - вполне реальное последствие потери зуба, но, к счастью, его можно предотвратить с помощью зубных имплантатов.

О стоматологах

Drs. Джеймс и Дженна Фейгенбаум - стоматологическая бригада отца и дочери в Крев-Кёр. Они предлагают множество вариантов замены зубов и являются экспертами в создании привлекательных функциональных реставраций на зубных имплантатах. Если вы хотите узнать больше о зубных имплантатах или назначить консультацию, свяжитесь с нашим офисом сегодня по телефону 314-567-1777.

Нравится:

Нравится Загрузка . ..

Связанные

Geib Gator 7,5 "Выбор стайлера для чистовой обработки 21 зуба

  • Покажи мне зеленую распродажу
  • Март Апрель Спец. Предложения
  • Последний шанс
  • Одежда
  • Банные системы
  • Бутылки и диспенсеры
  • Чаши
  • Банданы, банты, ленты, галстуки
  • Моющие и дезинфицирующие средства
  • Клиренс
  • Машинки для стрижки и запчасти
  • Лезвия для машинки
  • Системы пылесоса Clipper
  • Одеколоны
  • Творческий уход
  • Стоматологическая помощь
  • Сушилки и запчасти
  • Уход за ушами
  • Образовательный
  • Уход за глазами
  • Блохи и клещи
  • Уход за телом
  • Инструменты для ухода
  • Цвет волос
  • Здравоохранение
  • Уход за ногтями
  • Новые продукты
  • Организационная
  • Ограничители и намордники
  • Сезонно
  • Шампуни, кондиционеры и спреи
  • Ножницы
  • Программное обеспечение
  • Игрушки и угощения
  • Ветеринарные товары

Номер позиции: gdg21tf
Цена за единицу: 90 долларов. 99
В наличии
Количество
Отзывы клиентов
Щелкните здесь, чтобы просмотреть этот товар

Подробное описание
Ножницы Geib Gator изготовлены из высококачественного сплава нержавеющей стали, который позволяет отточить лезвие до бритвенной остроты для сверхгладкого стрижки, баланса и комфорта.

Лучше меньше, да лучше: подход 21 века к лечению кариеса

На протяжении более столетия стоматологи лечили кариес, удаляя как больные части зуба, так и здоровую структуру, которая считалась подверженной риску разрушения в будущем. Однако в 1970-х годах появился новый подход, известный как минимально инвазивная стоматология (MID). Этот протокол практики пытается сохранить как можно больше здоровой структуры.

До появления MID стоматологи следовали протоколу лечения кариеса, разработанному в 19 веке. Часть этого стала известна как расширение для профилактики , призывающее стоматологов удалить здоровые структуры, которые считаются уязвимыми для разрушения. Помимо уменьшения объема зуба, эта практика также привела к, по сегодняшним меркам, пломбам большего размера, чем необходимо.

Считалось, что удаление этого дополнительного материала упростит очистку бактериального налета, источника кариеса, но позже исследования показали, что такая практика не может гарантировать, что зубы не будут повторно инфицированы.

С тех пор мы узнали намного больше о зубах и разработали новые способы обнаружения кариеса на более ранних стадиях. Например, рентгеновская визуализация в значительной степени перешла от пленочной к цифровой технологии, обеспечивая более детальные изображения при большем увеличении. Это, наряду с лазерной флуоресценцией и инфракрасными камерами, облегчило обнаружение первых крошечных стадий распада.

Мы также можем ограничить повреждение кариеса, повысив прочность эмали с помощью фторидных аппликаций и герметиков или уменьшив количество вызывающих кариес бактерий с помощью антибактериальных ополаскивателей.Мы также наблюдаем прогресс в таких технологиях, как воздушная абразия, которые удаляют разрушенный зубной материал, оставляя более здоровую структуру нетронутой лучше, чем при использовании традиционной стоматологической бормашины.

Восстановление зубов после лечения также улучшилось. В то время как стоматологическая металлическая амальгама все еще используется для некоторых пломб, основным выбором в настоящее время является композитная смола. Эти новые стоматологические материалы цвета зубов требуют меньшего количества препарирования зубов (и, следовательно, меньших потерь материала) и хорошо сцепляются с остальной структурой, в результате чего зуб становится более прочным.

Следование протоколу MID приводит к меньшему вмешательству и меньшему времени нахождения в кресле стоматолога. Это также означает сохранение большего количества естественного зуба, что является важной целью в обеспечении длительного здоровья зубов.

Если вам нужна дополнительная информация о минимально инвазивной стоматологии, свяжитесь с нами или запишитесь на консультацию.

Подход 21 века к лечению кариеса

Автор: Семейная стоматологическая группа Foothill опубликовано: 22 сентября 2020 г.

Более века стоматологи лечили кариес, удаляя как больные части зуба, так и здоровую структуру, которая считается подверженной риску разрушения в будущем. Однако в 1970-х годах появился новый подход, известный как минимально инвазивная стоматология (MID). Этот протокол практики пытается сохранить как можно больше здоровой структуры.

До появления MID стоматологи следовали протоколу лечения кариеса, разработанному в 19 веке. Часть этого стала известна как расширение для профилактики , призывающее стоматологов удалить здоровые структуры, которые считаются уязвимыми для разрушения.Помимо уменьшения объема зуба, эта практика также привела к, по сегодняшним меркам, пломбам большего размера, чем необходимо.

Считалось, что удаление этого дополнительного материала упростит очистку бактериального налета, источника кариеса, но позже исследования показали, что такая практика не может гарантировать, что зубы не будут повторно инфицированы.

С тех пор мы узнали намного больше о зубах и разработали новые способы обнаружения кариеса на более ранних стадиях. Например, рентгеновская визуализация в значительной степени перешла от пленочной к цифровой технологии, обеспечивая более детальные изображения при большем увеличении.Это, наряду с лазерной флуоресценцией и инфракрасными камерами, облегчило обнаружение первых крошечных стадий распада.

Мы также можем ограничить повреждение кариеса, повысив прочность эмали с помощью фторидных аппликаций и герметиков или уменьшив количество вызывающих кариес бактерий с помощью антибактериальных ополаскивателей. Мы также наблюдаем прогресс в таких технологиях, как воздушная абразия, которые удаляют разрушенный зубной материал, оставляя более здоровую структуру нетронутой лучше, чем при использовании традиционной стоматологической бормашины.

Улучшилось и восстановление зубов после лечения.В то время как стоматологическая металлическая амальгама все еще используется для некоторых пломб, основным выбором в настоящее время является композитная смола. Эти новые стоматологические материалы цвета зубов требуют меньшего количества препарирования зубов (и, следовательно, меньших потерь материала) и хорошо сцепляются с остальной структурой, в результате чего зуб становится более прочным.

Следование протоколу MID приводит к меньшему вмешательству и меньшему времени нахождения в кресле стоматолога. Это также означает сохранение большего количества естественного зуба, что является важной целью в обеспечении длительного здоровья зубов.

Если вам нужна дополнительная информация о минимально инвазивной стоматологии, свяжитесь с нами или назначьте встречу для консультации.

Удаление зубов у малышей увеличилось на четверть за 10 лет | Общество

Число случаев удаления зубов детям в возрасте четырех лет и младше в английских больницах увеличилось почти на четверть за последнее десятилетие.

Данные

NHS, полученные факультетом стоматологической хирургии Королевского колледжа хирургов (RCS), показывают, что в 2015–2016 годах в возрастной группе было произведено 9 206 удалений по сравнению с 7 444 в 2006-07 годах, что на 24% больше.

Цифры побудили родителей, правительство и пищевую промышленность принять меры, чтобы обратить вспять тревожную тенденцию.

Профессор Найджел Хант, декан факультета стоматологической хирургии RCS, сказал: «Когда вы видите такие подсчеты, становится совершенно ясно, что сладкие привычки наших детей разрушительно влияют на состояние их зубов.

«То, что детям в возрасте одного или двух лет нужно удалять зубы, шокирует. Почти наверняка большинство этих удалений связано с кариесом, вызванным слишком большим количеством сахара в рационе.”

Рост произошел благодаря тому, что количество детей в возрасте четырех лет и младше в Англии выросло на 16% за тот же период.

Хант сказал, что люди не должны останавливаться на достигнутом по поводу удаления молочных зубов, поскольку они «задают образец для взрослых зубов, включая кариес».

Он сказал, что 90% кариеса можно предотвратить за счет снижения потребления сахара, регулярной чистки зубов фторсодержащей зубной пастой и регулярных посещений стоматолога, но 42% детей не посещали стоматолога в 2015–16 годах, несмотря на то, что лечение было бесплатным для детей в возрасте до 18 лет.

«Мы хотели бы, чтобы значительная часть денег, собранных за счет государственных налоговых сборов, была потрачена на образование в области гигиены полости рта», - сказал он. «Сахар почти сразу же оказывает разрушительное воздействие на зубы, и если мы научим родителей и детей сокращать сладкие лакомства и правильно ухаживать за зубами, это также окажет положительное влияние на показатели детского ожирения».

Британская стоматологическая ассоциация (BDA) заявила, что министры в Англии предложили «коллективное пожатие плечами» в отношении проблемы по сравнению со специальными программами, проводимыми правительствами Шотландии и Уэльса, «которые оказали преобразующее воздействие на здоровье полости рта детей».

Председатель BDA Мик Армстронг сказал, что существует глубокое неравенство, которое «требует реальной приверженности со стороны правительства, а не просто символических усилий».

Кэтрин Дженнер, директор кампании Action on Sugar, посетовала на рост добавленного сахара, но также призвала к изменению культуры.

«Добавленный сахар нашел свое место почти во всех продуктах питания, и использование сахара в качестве средства успокоения, развлечения или вознаграждения детей стало нормой, тогда как сахар должен быть редким удовольствием», - сказала она.

«Сахаросодержащие напитки являются самым большим источником сахара в рационе детей и подростков, и, если их не уменьшить, эти напитки по-прежнему будут способствовать высокому уровню ожирения, диабета 2 типа и кариеса - все это можно предотвратить. и ежегодно обходится NHS в миллиарды фунтов ».

Последнее национальное исследование диеты и питания показало, что в 2012–2014 годах дети в возрасте от полутора до трех лет потребляли в среднем 63 г сахаросодержащих безалкогольных напитков в день.

Цифры RCS также показывают, что детям в возрасте девяти лет и младше было выполнено более 34 000 удалений в каждом из последних двух лет по сравнению с 27 760 в 2005-06 гг.

Представитель правительства сказал: «Мы вводим налог на безалкогольные напитки, а также более широкую программу по снижению сахара, чтобы побудить компании, производящие продукты питания и напитки, в первую очередь сократить количество сахара, который содержится в популярных продуктах».

Служба общественного здравоохранения Англии посоветовала родителям следить за тем, чтобы их дети соблюдали правила гигиены полости рта, в том числе ограничивали употребление сладких продуктов и напитков.

Savox Sh21M - Набор пластиковых микро сервоприводов для сервоприводов с металлическими зубчатыми колесами, 21 зуб - Savox USA

{{еще}} {{#unless split_search}}

Продукты

{{#if has_results}}
    {{#each results}}
  • {{#if on_sale}}

    {{@root.on_sale_label}}

    {{/если}}

    {{заглавие}}

    {{#if on_sale #}} {{цена}} {{compare_at_price}} {{еще}} {{цена}} {{/если}}
  • {{/каждый}}
{{results_label}} {{еще}}

{{results_label}}

{{/если}} {{еще}}

Продукты

{{#if has_products_results}}
    {{#each products. полученные результаты}}
  • {{#if on_sale}}

    {{@ root.on_sale_label}}

    {{/если}}

    {{заглавие}}

    {{#if on_sale #}} {{цена}} {{compare_at_price}} {{еще}} {{цена}} {{/если}}
  • {{/каждый}}
{{products.results_label}} {{еще}}

{{products.results_label}}

{{/если}} {{/пока не}} {{/если}}

Интронный энхансер Bmp6 лежит в основе роста зубов у колюшки

Abstract

Трехиглая колюшка предлагает мощную систему для анализа генетической основы морфологической эволюции в природе. Морские колюшки неоднократно вторгались и адаптировались к многочисленным пресноводным средам по всему Северному полушарию.В ответ на новые диеты в пресноводных средах обитания в производных пресноводных популяциях произошли изменения черепно-лицевой морфологии, включая наследственное увеличение числа зубов. Используя комбинацию количественной генетики и повторного секвенирования генома, здесь мы точно картировали локус количественных признаков (QTL), регулирующий эволюцию роста зубов, в кластер из десяти QTL-ассоциированных однонуклеотидных вариантов, все в четвертом интроне Bone Morphogenetic Protein 6 ( Bmp6 ). Анализы трансгенных репортеров показали, что эта интронная область содержит усилитель зуба.Мы индуцировали мутации в Bmp6 , выявив необходимые роли для выживания, роста и формирования зубного рисунка. Транскрипционное профилирование мутантных тканей зубов Bmp6 и выявило значительное подавление набора генов, ортологи которых, как ранее было показано, экспрессируются в покоящихся стволовых клетках волосков мыши. В совокупности эти данные подтверждают модель, в которой мутации внутри интронного усилителя зубов Bmp6 вносят вклад в развитие эволюционирующих зубов, и предполагают, что древние общие генетические схемы регулируют регенерацию различных эпителиальных придатков позвоночных, включая волосы млекопитающих и зубы рыб.

Информация об авторе

Понимание того, как развиваются черты характера в природе, остается фундаментальной целью биологии. Трехиглая колюшка предлагает мощную систему для решения этого вопроса. Морские колюшки-предки заселили новые пресноводные среды, в которых развиваются новые черты, включая увеличение числа зубов. Это эволюционировавшее увеличение числа зубов возникает на поздних стадиях развития и связано с ускорением замещения зубов у высокозубых пресноводных рыб. Используя генетические и геномные данные, здесь мы картировали геномную область, регулирующую эволюционировавший рост зубов, с интронной областью Bone Morphogenetic Protein 6 ( Bmp6 ).Эта интронная область содержит энхансер транскрипции, который управляет экспрессией генов во время развития и замены зубов. Мы индуцировали мутации в кодирующей области Bmp6 и обнаружили необходимые роли для Bmp6 в жизнеспособности, росте и формировании зубного рисунка. Сравнивая данные по геномной экспрессии генов в тканях зубов дикого типа и мутантных Bmp6 тканей зубов, мы обнаружили значительное подавление набора генов, ортологи которых, как ранее было показано, экспрессируются в покоящихся стволовых клетках волосков мыши.В совокупности эти данные подтверждают модель, в которой мутации внутри интронного усилителя зуба Bmp6 вносят вклад в эволюционировавший рост зубов, и предполагают, что различные эпителиальные придатки позвоночных, такие как зубы и волосы, регенерируют с использованием древней общей генетической программы.

Образец цитирования: Cleves PA, Hart JC, Agoglia RM, Jimenez MT, Erickson PA, Gai L, et al. (2018) Интронный энхансер Bmp6 лежит в основе эволюции роста зубов у колюшки. PLoS Genet 14 (6): e1007449.https://doi.org/10.1371/journal.pgen.1007449

Редактор: Сесилия Моенс, Онкологический исследовательский центр Фреда Хатчинсона, США

Поступила: 19 декабря 2017 г .; Дата принятия: 25 мая 2018 г .; Опубликован: 14 июня 2018 г.

Авторские права: © 2018 Cleves et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Считанные данные генома и транскриптома доступны из короткого архива чтения NCBI (SRP141523). Все остальные соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

Финансирование: Эта работа была частично поддержана стипендией NSF Graduate Research Fellowship (PAC), NIH Genetics Training Grant 5T32GM007127 (PAC и PAE), NIH Genomics Training Grant 5T32HG000047-15 (JCH), NSF EDEN Undergraduate Training Grant (IOS) № 0955517 для LG) и NIH R01-DE021475 (CTM).В этой работе использовалась лаборатория геномного секвенирования Винсента Дж. Коутса в Калифорнийском университете в Беркли при поддержке NIH S10 Instrumentation Grants S10RR029668 и S10RR027303. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Поиск генов и, в конечном итоге, мутаций, которые управляют эволюцией животных форм, остается важной целью биологии [1]. Гипотеза регуляции цис предполагает, что регуляторные изменения цис являются наиболее частым субстратом для морфологической эволюции, потому что эти мутации с большей вероятностью обходят отрицательную плейотропию, обычно генерируемую кодирующими мутациями в онтогенетических регуляторных генах [2]. Хотя многие исследования на множестве организмов обнаружили цис-регуляторных аллелей , лежащих в основе морфологической эволюции, мало известно о том, почему и как используются цис-регуляторные аллели [3,4].Например, для генов, имеющих цис- -регуляторные аллели, связанные с эволюционировавшими различиями, вопрос о том, вызывают ли кодирующие мутации отрицательную плейотропию и / или сниженную приспособленность, остается в значительной степени непроверенным во многих естественных популяциях.

Зубы - это классическая модельная система для изучения развития и эволюции органов позвоночных [5,6]. Во время развития зубов эпителиальные и мезенхимные клетки реципрокно передают друг другу сигналы, интегрируя динамические сигналы BMP, TGF-β, FGF, SHH, Notch, Activin, EDA и Wnt, чтобы управлять формированием зрелого зуба [7,8].Передача сигналов костным морфогенетическим белком (BMP) играет несколько критических ролей во время развития зубов. Во время зарождения зуба эпителиальный Bmp4 ингибирует экспрессию Pax9 и Pitx2 , маркеров развития формирующейся плакоды зуба [9,10]. Эти результаты предполагают ингибирующую роль передачи сигналов BMP на развитие зубов. Однако несколько линий доказательств подтверждают активирующую роль BMP в развитии зубов. Напр., Экзогенный Bmp4 может спасать развитие зубов у мутантных мышей Msx1 и ускорять развитие зубов в культивируемых нижних челюстях зубов, подтверждая активирующую роль передачи сигналов BMP [11,12].Более того, у мышей с удалением в зубном эпителии рецептора BMP, Bmpr1a , или трансгенных по конструкции, сверхэкспрессирующей антагонист BMP, Noggin , в зубном эпителии наблюдается остановка зуба на стадии зачатка и стадии плакоды, соответственно [13,14]. Вместе эти результаты предполагают, что существуют как активирующие, так и ингибирующие роли передачи сигналов BMP во время развития зубов. Однако роли многих компонентов передачи сигналов BMP до конца не изучены. Кроме того, генетические пути раннего рисунка и зарождения зубов были тщательно изучены и хорошо охарактеризованы на мышах.Поскольку мыши являются грызунами-монофиодонтами, которые не заменяют свои зубы, о генетической основе замены зубов известно значительно меньше. Позвоночные полифиодонты (например, акулы, костистые и рептилии), которые постоянно заменяют свои зубы, дают возможность изучить генетические и эволюционные основы регенерации зубов [6].

Трехиглая колюшка ( Gasterosteus aculeatus ) - отличная модель для понимания молекулярно-генетической основы естественной изменчивости, включая эволюционировавшие различия в количестве зубов [15,16].Колюшки подверглись драматической адаптивной радиации, в результате которой предки морской колюшки колонизировали пресноводные озера и ручьи по всему Северному полушарию [17]. Недавние генетические исследования выявили, что cis -регулирующие изменения онтогенетических сигнальных молекул лежат в основе нескольких аспектов морфологической эволюции колюшки [18–23]. Полногеномный поиск регионов, находящихся под отбором во время пресноводной адаптации, обнаружил обогащение некодирующими элементами генома, что дополнительно указывает на регулирующие изменения цис в лежащей в основе эволюции колюшки [24].

Пресноводные колюшки развили несколько морфологических адаптаций скелета головы, некоторые, вероятно, из-за перехода к питанию более крупной добычей в пресноводных нишах [25]. В то время как многие виды адаптации колюшек к пресной воде связаны с потерей скелета, конструктивное увеличение числа глоточных зубов наблюдается в пресноводных популяциях бентоса (адаптированных к дну озера) и ручьях [19,26]. Глоточные зубы лежат в глотке рыб и являются серийными и филогенетическими гомологами оральных зубов млекопитающих [27]. Формирование рисунка глотки на челюсти - это адаптивный признак у рыб, который зависит от диеты и экологической ниши [28]. Многие аспекты онтогенетической генетической схемы, регулирующей развитие зубов, сохраняются от мышей к рыбам [29–31]. Таким образом, эволюционировавший рост зубов у колюшки дает прекрасную возможность понять эволюционную генетику развития и замены зубов.

Развитое увеличение зубов у донных пресноводных рыб из озера Пакстон в Британской Колумбии сопровождается увеличением размера зубного поля, уменьшением расстояния между зубами и увеличением частоты замены зубов на поздних стадиях развития [19,26] (Таблица 1, столбцы 1–3).Ранее мы показали, что этот производный зубной паттерн частично объясняется большим влиянием локуса количественных признаков (QTL) на хромосому 21, который связан с поздним действием cis -регулирующим подавлением экспрессии Bmp6 из бентосных аллелей в тканях зубов [ 19] (таблица 1, столбец 4). Эти результаты делают Bmp6 отличным геном-кандидатом для основного развития эволюционирующих зубов за счет регулирования формирования зубного рисунка и замены. Поскольку не было обнаружено изменений в кодировании между морскими и бентосными пресноводными аллелями Bmp6 [19], мы попытались составить карту кандидатных регуляторных областей Bmp6 , связанных с эволюционировавшим приростом зубов.Здесь мы используем комбинацию рекомбинантного картирования, сравнительной геномики, редактирования генома и транскрипционного профилирования для дальнейшего анализа молекулярно-генетической основы эволюции роста зубов и роли Bmp6 во время развития зубов у трехиглой колюшки.

Результаты

Рекомбинантное картирование хромосомы 21 номер зуба QTL идентифицирует интервал 884 kb, содержащий

Bmp6

Мы ранее идентифицировали и точно сопоставили зуб QTL с большим эффектом, равным 2.56 Mb 1,5-LOD интервал на хромосоме 21 колюшки, содержащей превосходный ген-кандидат, Bone Morphogenetic Protein 6 ( Bmp6 ), наряду с 58 другими предсказанными генами [19,32]. Для дальнейшего точного картирования этого QTL мы идентифицировали три хромосомы с событиями морской-бентосной рекомбинации в интервале точного картирования 2,56 Мб (рис. 1). Рыбы с каждой из этих рекомбинантных хромосом были скрещены с рыбами, гетерозиготными по морским и бентосным аллелям хромосомы 21, чтобы произвести большие (> 100 рыб в каждой) кроссы, чтобы проверить влияние этих рекомбинантных хромосом на количество зубов (рис. 1A, таблица S1).Рекомбинантные хромосомы, которые увеличивают количество зубов по сравнению с морскими хромосомами, предполагают, что контролирующая зубы область хромосомы 21 находится в придонной части рекомбинантной хромосомы. Мы использовали тест отношения правдоподобия, чтобы определить, ведет ли каждая рекомбинантная хромосома больше как морская или бентическая хромосома. Рекомбинантные хромосомы 1 и 3 увеличили количество зубцов, каждая из которых ведет себя как бентосный аллель хромосомы 21 (значение P из теста отношения правдоподобия = 3.0 x 10 −4 для обоих) (рис. 1B). Рекомбинантная хромосома 2 не увеличивала количество зубцов, ведя себя как морской аллель хромосомы 21 ( P = 1 x 10 −3 из теста отношения правдоподобия) (рис. 1B). Вместе эти рекомбинантные скрещивания поддерживают новый меньший генетический интервал, 884 т.п.н. в референсной сборке генома колюшки [24], который содержит 21 предсказанный ген, включая Bmp6 (рис. 1C), уменьшая физический размер интервала и количество генов на 65% и 64% соответственно.

Рис. 1. Рекомбинантное картирование QTL зубца 21 хромосомы поддерживает интервал 884 kb, содержащий Bmp6 .

(А). Схема трех рекомбинантных скрещиваний. В каждом скрещивании рыб, гетерозиготных по рекомбинантным и морским (кросс 1 и 3) или рекомбинантным и бентосным (кросс 2) аллелям хромосомы 21, скрещивали с рыбами, гетерозиготными по нерекомбинантным морским и бентосным аллелям хромосомы 21. Для каждого скрещивания мультфильмы квадратов Паннета, с гаплоидными генотипами слева и вверху и четыре класса результирующих диплоидных генотипов, показанных внизу справа.(B) Общее количество вентральных глоточных зубов с поправкой на размер и стандартная ошибка перечислены для каждого генотипического класса в каждом из рекомбинантных скрещиваний. Для каждого скрещивания перечисляются и кодируются родительские генотипы QTL зуба: морской (M), бентосный (B) или рекомбинантный (R). Тесты отношения правдоподобия использовались для проверки того, ведут ли эффекты рекомбинантных хромосом на количество зубов как морские или бентические хромосомы (см. Методы). P -значения из каждого теста отношения правдоподобия перечислены в столбце поддерживаемого направления в B.(C) QTL зубца 21 хромосомы ранее был точно картирован в область 2,56 Mb, содержащую Bmp6 вместе с 58 другими предсказанными Ensembl генами [19]. Показаны три протестированные рекомбинантные хромосомы 21. Генотипы окрашены в красный цвет для морских, синий для бентосных и серый для нерешенных. Стрелки обозначают положение зубца QTL, поддерживаемое каждой рекомбинантной хромосомой. Конечный рекомбинантный картированный интервал составляет 884 т.п.н. в сборке референсного генома и содержит 21 предсказанный ген, включая Bmp6 .

https://doi.org/10.1371/journal.pgen.1007449.g001

Семь из восьми производных бентосных хромосом имеют зубец большого эффекта QTL

Чтобы оценить частоту аллеля с большим числом зубов хромосомы 21 в бентосной популяции дикого Пакстона, мы создали шесть морских и бентосных скрещиваний F2, тестируя восемь бентосных хромосом дикого происхождения (названные B 1 -B 8 , рис. Таблица S2). Эти хромосомы имели разные генотипы в трех микросателлитных локусах, расположенных в 5 ’, внутри и в 3’ от QTL 21 зубца хромосомы, что позволяет предположить, что они являются молекулярно разными дикими хромосомами (таблица S2, см. Методы).Мы обнаружили, что семь из этих восьми бентосных хромосом оказали значительное влияние на количество зубов с одинаковым направлением и одинаковой величиной эффекта (рис. 2, таблица S2). Бентическая хромосома, протестированная в скрещивании 6 (B 8 ), не оказала влияния на количество зубов (рис. 2, таблица S2). Эти результаты вместе предполагают, что аллель с высоким числом зубов на хромосоме 21 встречается с высокой частотой в бентосной популяции Пакстона, но по крайней мере один бентосный аллель с более низкой частотой не связан с увеличением числа зубов.

Рис. 2. Семь из восьми бентосных хромосом 21 имеют зубец QTL.

(A-F) Показаны результаты шести бентосных и морских скрещиваний F2, тестирующих восемь молекулярно различных (см. Методы) бентических хромосом 21 (B 1-8 ). (A-E) Бентические хромосомы 1–7 оказали сильное влияние на количество зубов; однако (F) бентосная хромосома 8 не оказала заметного воздействия на количество зубов. Показано общее количество зубов с обратной трансформацией у морских гомозиготных (красный), гетерозиготных (фиолетовый) и бентосных гомозиготных (синий) рыб по хромосоме 21 (см. Методы). P значения ANOVA для перекрестных 1–6 равны 0,002, 0,024, 0,0005, 0,004, 2,11x10 -5 , 0,69, соответственно (* = P < 0,05, *** = P <0,01) . Кресты F2 1, 3 и 4 проверяют по две бентосные хромосомы, а скрещивания 2, 5 и 6 проверяют одну. Кресты 1 и 4 имеют общую бентосную хромосому. См. Дополнительную информацию в таблице S2.

https://doi.org/10.1371/journal.pgen.1007449.g002

Пересеквенирование всего генома выявляет кластер QTL-ассоциированных вариантов в интроне 4

Bmp6

Мы предположили, что аллели бентосной хромосомы 21 Пакстона, которые увеличивают число зубов (B 1-7 , рис. 2), имеют общие варианты последовательностей, лежащие в основе эволюционного увеличения зубов, которые отсутствуют в морских аллелях или аллеле бентосной хромосомы 21 без QTL зуба (B 8 , рис 2).Чтобы проверить QTL-ассоциированные варианты, мы повторно секвенировали геномы четырех донных бабушек и дедушек из скрещиваний 1–4, двух рыб F2, гомозиготных по хромосомам B 7 и B 8 , и трех морских бабушек и дедушек из скрещиваний 2, 5, и 6 протестированы на рис. 2 (таблица S3). Мы идентифицировали 372 варианта последовательности (состоящие из 323 SNP и 49 инделей) в пределах тонко картированного генетического интервала 884 kb, которые присутствовали на всех бентосных хромосомах с большим эффектом QTL, но не присутствовали на морских хромосомах (рис. 3A).Мы дали вариантам оценку соответствия QTL: абсолютное значение доли случаев, когда вариантный аллель обнаруживается у донных рыб с QTL с зубцом 21 хромосомы, минус доля случаев, когда такой же аллель обнаруживается у рыб без QTL с зубцом. Только десять из этих вариантов (все SNP) были полностью связаны с присутствием QTL зубца (рис. 3). Поразительно, что все эти варианты лежат в области ~ 4,4 т.п.н. интрона 4 Bmp6 (рис. 3В, таблица S4).

Рис. 3. Сравнительная геномика выявляет QTL-ассоциированные варианты в интроне 4 Bmp6 .

(A) Сравнение геномных последовательностей QTL зуба с точным картированием (из рис. 1C) между морскими (n = 3, из скрещиваний 2, 5 и 6) и бентосными хромосомами с QTL зубца (n = 7, из скрещиваний). 1–5) идентифицировали набор вариантов с противоположными гомозиготными генотипами, окрашенными в красный цвет для морских (вверху) и синего цвета для бентосных (в центре). Обратите внимание, что показаны только позиции с противоположными гомозиготными генотипами в пределах этих 884 т.п.н. Бентосная хромосома без QTL (хромосома B 8 из скрещивания 6) имела кластер вариантов, разделяющих консенсусный морской генотип (внизу).(B) Все десять вариантов с идеальной ассоциацией QTL (красные точки) находятся в интроне 4 Bmp6 . Ось Y показывает оценку соответствия QTL (см. Методы), показатель соответствия между генотипом и наличием или отсутствием QTL зубца. Генная модель Bmp6, и окружающих генов основана на предсказаниях Ensembl [24].

https://doi.org/10.1371/journal.pgen.1007449.g003

QTL-ассоциированные варианты окружают энхансер зуба и плавника в интроне 4

Bmp6 , который управляет перекрывающимися и различными паттернами экспрессии в качестве энхансера Bmp6 5 ’

Ранее мы показали, что cis -регуляторное снижение экспрессии Bmp6 связано с QTL зубца 21 хромосомы у бентосных рыб Paxton, предполагая, что изменения в регуляторных элементах Bmp6 лежат в основе QTL зуба [19].Мы предположили, что область интрона 4, содержащая специфические варианты QTL зуба, является усилителем зуба Bmp6 (рис. 3B). Чтобы проверить функцию энхансера, мы клонировали геномный фрагмент интрона 4 размером ~ 2 т.п.н. из морских рыб в репортерную конструкцию (таблица S5). Трансгенные рыбы для этой конструкции экспрессировали GFP в дистальных концах развивающихся грудных и срединных плавников через восемь дней после оплодотворения (dpf), а также в глоточных и оральных зубах через 10 dpf (S1 фиг.). Ранее было показано, что эти домены являются эндогенными сайтами экспрессии Bmp6 и у развивающихся колючек [19,33].Эти результаты демонстрируют, что четвертый интрон Bmp6 содержит энхансер, активный в развитии зубов и плавников.

Чтобы определить минимально достаточный энхансер, мы субклонировали фрагмент размером ~ 2 т.п.н. в два меньших фрагмента размером ~ 1,3 т.п.н. и 511 п.н. на основе паттернов сохранения последовательности (рис. 4A, таблица S5) и протестировали функцию энхансера у морской колюшки. Конструкция 511 п.н. высококонсервативна для рыб и не содержит QTL-специфических вариантов. Конструкция 1,3 т.п.н. включает область 511 п.н. и менее консервативную область, которая содержит 6 из 10 специфичных для QTL вариантов.~ 800 п.н., включенные в конструкцию ~ 1,3 т.п.н., но не конструкцию из 511 п.н., не приводили к последовательной экспрессии, и не наблюдалось убедительных различий ни между конструкцией ~ 1,3 т.п.н. и конструкцией 511 п.н., либо морскими и бентосными версиями конструкции ~ 1,3 kb конструкцию на ранних эмбриональных и личиночных стадиях [n> 3 раундов инъекции каждый, n> 20 линз GFP + (внутренний контрольный домен, управляемый промотором Hsp701 ) для сравнений как ранних эмбрионов, так и ранних личинок]. И более крупный 1.Конструкция 3 т.п.н. и конструкция 511 п.н. вызывали экспрессию в дистальных краях срединного и грудного плавников при восьми dpf (фиг. 4B). К 13 dpf энхансер 511 bp управлял экспрессией в мезенхимальных клетках в развивающихся глоточных зубах, а также экспрессией в зубном эпителии (Рис. 4C). В развивающихся зубах GFP-позитивный мезенхимальный домен простирается от каждого зубного зачатка вглубь зубной пластинки (рис. 4С). Эта экспрессия зубов продолжалась на поздних ювенильных стадиях, когда различия в количестве глоточных зубов возникают между морскими и пресноводными популяциями (Рис. 4D) [19].Экспрессия GFP также была обнаружена в поздних ювенильных оральных зубах (рис. 4E). Эти результаты демонстрируют, что QTL-ассоциированные варианты интрона 4 зуба окружают энхансер, достаточный для управления экспрессией в развивающихся плавниках и зубах.

Рис. 4. Область интрона 4 с QTL-ассоциированными вариантами содержит энхансер зубца и плавника.

(A) Схема локуса Bmp6 . Все десять QTL-ассоциированных вариантов (красные отметки) расположены в интроне 4. Восемь из этих вариантов (красные звездочки) находятся в консервативной последовательности, развернутой ниже.Сохранение костистых насекомых показано в браузере генома UCSC (http://genome.ucsc.edu/). Черные столбцы показывают протестированные субклоны энхансеров размером ~ 2 т.п.н., 1,3 т.п.н. и 511 пар оснований. (B-E) Экспрессия репортера GFP из энхансера 511 п.н. у стабильных трансгенных рыб. (B) Через восемь дней после оплодотворения (dpf) экспрессия была обнаружена в развивающемся дистальном крае грудного («p») и срединном плавниках («m»). (C) К 13 dpf относительно слабая экспрессия GFP присутствовала в развивающемся зубном эпителии (наконечник стрелки), а более сильная экспрессия GFP присутствовала в мезенхиме (стрелки) на ранней стадии и полностью сформированных зубах (см. Рисунок S4 в [19] для временного хода. эпителия зубов и морфологии мезенхимы в целых группах).На поздних ювенильных стадиях экспрессия мезенхимы была обнаружена в развивающихся глоточных (D) и оральных (E) зубах. (F) Показаны 5 ’(звездочка) и интрон 4 (треугольник) усилители зуба Bmp6 . (G) Ранее описанный энхансер зуба 5 ’ Bmp6 [33] из 190 п.н. [33] приводил к перекрывающейся, но отличной экспрессии, чем интронный энхансер. По сравнению с интронным энхансером (C), 5 ’энхансер вызывал более стойкую экспрессию в эпителиальных клетках зубов (стрелки) и экспрессию в мезенхиме зубов (стрелка).(H) Рыба, дважды трансгенная по 5 ’энхансеру 190 п.н., управляющему GFP (зеленый), и энхансеру интрона 4 511 п.н., управляющему mCherry (пурпурный), позволяет напрямую сравнивать паттерны энхансеров. (I-I ’) На ранних стадиях развития зубов оба энхансера управляли мезенхимальной экспрессией (стрелки), в то время как 5’ энхансер, но не энхансер интрона 4, управляли сильной эпителиальной экспрессией (стрелки). (J, J ') По мере развития зуба мезенхимальная экспрессия интрона 4 (стрелка) распространялась на основание развивающегося зуба в клетках, не экспрессирующих 5' энхансер, в то время как 5 'энхансер продолжал управлять экспрессией как в эпителии, так и в мезенхимальные клетки.I и J показывают наложение каналов GFP и mCherry, I ’и J’ показывают только каналы GFP. Белые звездочки в I, I ’, J и J’ обозначают минерализованные зубы. Кость контрастирует с ализариновым красным цветом (C-E, G). Масштабные линейки составляют 100 мкм (B-G) и 10 мкм (I-J).

https://doi.org/10.1371/journal.pgen.1007449.g004

Ранее мы идентифицировали TGFβ-чувствительный 5 ’энхансер Bmp6 , который также управляет экспрессией в развивающихся зубах и плавниках у колюшки [33]. Поскольку экспрессия колюшки Bmp6 сложна в пространстве и времени в развивающихся зубах [19], мы предположили, что два регуляторных элемента могут контролировать разные аспекты экспрессии Bmp6 в зубах.Чтобы проверить эту гипотезу, мы сравнили паттерны экспрессии GFP у рыб, стабильно трансгенных по репортерным генам, для 5 ’энхансера зуба на 190 п.н. или интрона 4-го зуба на 511 п.н. (рис. 4C, 4F и 4G). Как описано ранее [33], мы обнаружили, что 5 ’энхансер управляет устойчивой экспрессией в развивающемся эпителии зубов и прилегающей мезенхиме зубов (рис. 4G). Мы обнаружили, что энхансер интрона 4 управлял экспрессией, которая казалась отличной от 5 ’энхансера на некоторых стадиях развития зуба (рис. 4C и 4G).Интронный энхансер стимулировал экспрессию в мезенхимальных ядрах зрелых зубов, аналогично экспрессии, управляемой 5 ’энхансером. Однако интронный энхансер вызывал более глубокую экспрессию мезенхимы вокруг основания развивающегося зуба по сравнению с 5 ’энхансером (рис. 4C и 4G).

Для непосредственного сравнения доменов экспрессии зубов, управляемых двумя энхансерами, мы создали трансгенных рыб как для репортерной конструкции mCherry, энхансера интрона 4 511 п.н., так и для репортерной конструкции GFP с 5’-зубным энхансером на 190 п.н. [33] (рис. 4H).Домены экспрессии зубов частично перекрывались между двумя усилителями в развивающихся зубах (рис. 4I и 4J). Как было замечено при сравнении стабильных линий, оба энхансера управляют сходной экспрессией мезенхимы на ранних стадиях развития зуба, но 5 ’энхансер, а не энхансер интрона 4, вызывают сильную эпителиальную экспрессию на этих стадиях (рис. 4I и 4I’). По мере развития зуба энхансер интрона 4 управлял экспрессией в основании минерализованного зуба в мезенхимальных клетках, которые не экспрессировали 5 ’энхансер (рис. 4J и 4J’).Эти результаты предполагают, что экспрессия Bmp6 и в эпителиальных и мезенхимальных клетках зубов управляется по крайней мере двумя энхансерами, которые управляют частично перекрывающимися, но разными паттернами экспрессии.

Индуцированные мутации у колюшки

Bmp6

Чтобы проверить, требуется ли Bmp6 для формирования зубного рисунка у колюшки, мы использовали эффекторные нуклеазы, подобные активатору транскрипции (TALEN), чтобы произвести две предсказанные мутации потери функции у колюшки Bmp6 (рис. 5A, таблица S6).Мы разработали пару TALEN для нацеливания на высококонсервативный второй экзон Bmp6 , который находится в 5 ’от экзонов, кодирующих предсказанный секретируемый лиганд. Таким образом, можно предположить, что ранние стоп-кодоны будут генерировать сильные аллели потери функции. Инъекция этих РНК TALEN в эмбрионы колюшки эффективно индуцировала мутации в последовательности-мишени Bmp6 . Для выявления мутаций в рыбе, инъецированной F 0 , и мутаций, передаваемых через зародышевую линию у рыб F 1 , мы с помощью ПЦР амплифицировали окружающую последовательность вокруг целевого сайта, расщепили этот ампликон с помощью EcoR I, затем экстрагировали гель и секвенировали неразрезанные ремешок (S2 Рис).Мы обнаружили, что 24–57% инъецированных эмбрионов колюшки F 0 имели обнаруживаемые делеции, причем до 12% этих эмбрионов, по-видимому, имели двуаллельные мутации (S2 Рис). В соответствии с предыдущими исследованиями с использованием TALENs у рыб, мы идентифицировали спектр вставок и делеций в целевом сайте (Рис. 5B) [34]. Мы создали два мутантных аллеля, которые мы скрестили для проверки фенотипов: (1) делеция 13 п.н. и (2) делеция 3 п.н. плюс вставка 4 п.н. (рис. 5B жирным шрифтом). Предполагается, что обе эти мутации вызывают сдвиги рамки считывания и ранний стоп-кодон 5 ’к секретируемому лиганду BMP и, таким образом, обе являются вероятными аллелями с сильной потерей функции (S3 фиг.).

Рис. 5. Bmp6 необходим для жизнеспособности, роста и формирования зубного рисунка.

(A) Схема пары TALEN (зеленый), нацеленной на сайт EcoR I (звездочка) во втором экзоне Bmp6 . (B) Секвенирование по Сэнгеру рыб F 0 или F 1 выявило спектр геномных делеций (двоеточие) и вставок (красный) в Bmp6 . Две мутации, использованные в этом исследовании, выделены жирным шрифтом. В последовательности дикого типа сайт EcoR I показан синим, а края нацеливающих последовательностей TALEN показаны зеленым.(C) Конфокальные изображения ранних молодых (общая длина 16-17 мм) дикого типа (слева) и гомозиготных мутантов (справа) вентральных пластинок глоточных зубов, демонстрирующих меньшее количество зубов у мутанта. Показанный мутант представляет собой трансгетерозиготу для делеции 13 п.н. и делеции 3 п.н. + вставки 4 п.н. Масштабная линейка 200 мкм. (D-F) Время развития числа зубов (D), площади зубной пластинки (E) и расстояния между зубами (F) у рыб дикого типа (синий), гетерозиготных (фиолетовый) и гомозиготных мутантов (красный). (D-E) Гомозиготные рыбы имеют рецессивное уменьшение числа зубов и площади зубной пластинки на ранней ювенильной стадии (значения Tukey post-hoc P , сравнивающие дикий тип с гомозиготным мутантом, равны 9.3 x10 -6 и 0,004, соответственно, и при сравнении гетерозиготного с гомозиготным мутантом 1,3x10 -4 и 0,08 соответственно). Число и площадь зубов у рыб дикого типа и гетерозиготных рыб на поздних стадиях развития отличаются. (F) Расстояние между зубами у мутанта существенно не отличается ни на одной стадии. Поздние скрещивания молоди и взрослой особи были гетерозиготными мутантными скрещиваниями с рыбами дикого типа. Для D-F гомозиготные мутанты включают как рыб, гомозиготных по делеционной мутации 13 п.н., так и трансгетерозиготных по делеции 13 п.н. и делеции 3 п.н. + вставку 4 п.н. (см. Таблицу S7 и файл исходных данных файла S1).

https://doi.org/10.1371/journal.pgen.1007449.g005

Bmp6 требуется для жизнеспособности, роста и формирования зубного рисунка

Чтобы проверить фенотип формирования зубного рисунка у мутантов Bmp6 и , мы скрестили рыб, которые были гетерозиготными по делеции 13 п.н. или делеции 3 п.н. плюс вставка 4 п.н. и увеличили время развития. Гомозиготные мутанты были недостаточно представлены в ожидаемых соотношениях на более поздних стадиях развития, что свидетельствует о ранней ювенильной летальности (таблица S7).Выжившие гомозиготные мутанты имели тенденцию быть немного меньше (таблица S7). Из-за летальности на поздних стадиях мы продолжили временной ход мутанта Bmp6 и с гетерозиготными бэккроссами для поздних ювенильных и взрослых стадий. Чтобы проверить необходимую роль Bmp6 в формировании зубного паттерна, мы количественно определили количество вентральных глоточных зубов, площадь зубной пластинки (размер зубного поля) и расстояние между зубами, три фенотипа, контролируемых хромосомой 21 зуба QTL [19] в Bmp6 мутантный ход времени (рис. 5C – 5F).На ранней стадии молоди у гомозиготных мутантов наблюдалось уменьшение как числа зубов, так и площади зубной пластинки по сравнению с рыбами дикого типа или гетерозиготными рыбами (рис. 5D и 5E; таблица 1, столбец 5). Начиная с ранней молоди, у гетерозиготных рыб было меньше вентральных зубов и меньшая площадь зубных пластинок, которые были значительно меньше в более поздние моменты времени, включая взрослых особей (рис. 5D и 5E; таблица 1, столбец 6). Не было значительных различий в расстоянии между зубами на любом этапе (рис. 5F). Эти результаты показывают, что Bmp6 требуется для указания номера зуба и размера поля зуба.Чтобы проверить, имеют ли рыбы, трансгетерозиготные по делеции 13 п.н. и делеции 3 п.н. / вставке 4 п.н., фенотип формирования зубного рисунка, мы создали кроссгетерозиготный кросс с использованием двух различных мутантных аллелей Bmp6 . Мы обнаружили, что рыбы, трансгетерозиготные по двум разным мутациям, имели сходный фенотип формирования зубного рисунка, как и рыбы, гомозиготные по делеции 13 п.н. (таблица S8).

В дополнение к двусторонним вентральным зубным пластинам, глоточные зубы колюшки также присутствуют на двух двусторонних дорсальных зубных пластинах, дорсальной зубной пластине 1 (DTP1) и дорсальной зубной пластине 2 (DTP2) [35].Затем мы спросили, регулирует ли Bmp6 также количество дорсальных глоточных зубов. Мы не обнаружили существенных различий в количестве зубов каждой из дорсальных зубных пластин на ранних стадиях развития (S4 Рис). У взрослых количество зубов DTP2 было значительно ниже у гетерозиготных мутантов, но в меньшей степени, чем различия в количестве вентральных зубов на той же стадии (S4 Рис.). Для обеих дорсальных зубных пластин номера зубов имели тенденцию к тому же направлению, что и для вентральных зубных пластин, с меньшим количеством зубов у мутантов, чем у диких типов.Эти результаты демонстрируют, что, как и QTL зуба 21 хромосомы [32], доза Bmp6 оказывает более сильное влияние на количество вентральных глоточных зубов, чем количество дорсальных глоточных зубов.

Bmp6 регулирует ортологи генов-мишеней BMP, гены сигнального пути TGF-β и гены, активируемые в стволовых клетках волосяных фолликулов мыши

Чтобы начать идентификацию генетических сетей ниже Bmp6 , мы выполнили РНК-секвенирование ранних ювенильных пластинок дикого типа и гомозиготных мутантных двусторонних глоточных зубных пластин с делецией 13 п.н. (n = 3 каждого генотипа, таблица S9).После картирования чтения и количественной оценки экспрессии генов мы выполнили анализ основных компонентов нормализованного количества считываний всего набора данных (рис. 6A). PC1 объясняет большую часть общей дисперсии (31,15%) и различает гомозиготные образцы Bmp6 дикого типа и мутантные образцы (рис. 6A). Кроме того, гены, экспрессия которых коррелировала с первым главным компонентом, были сильно обогащены терминами генной онтологии, относящимися к развитию и передаче сигналов клетки (таблица S10).

Рис. 6. Транскрипционное профилирование показывает, что компоненты передачи сигналов TGF-β, гены-мишени BMP и гены сигнатуры стволовых клеток волосяного фолликула подавлены в мутантных зубных пластинах Bmp6 .

(A) Анализ главных компонентов уровней экспрессии в масштабе всего генома в ткани пластинки поздних ювенильных вентральных глоточных зубов с помощью RNA-seq разделяет мутанты дикого типа (Wt, синий) и Bmp6 (Mut, красный) вдоль PC1. (B) Гены-мишени BMP в развивающемся эпителии и мезенхиме зубов [8] не были затронуты (левая полоса) и значительно подавлены ( P = 1.25 x 10 −2 , средняя полоса) у мутанта соответственно. Набор генов-мишеней BMP [36] был значительно подавлен у мутантов ( P = 3,12 x 10 -4 , правая полоса). (C) Экспрессия сигнальных путей ToothCODE. Гомозиготные мутантные рыбы (Mut) имели значительно более низкую экспрессию пути TGF-β по сравнению с рыбами дикого типа (WT) ( P = 4,7 × 10 -3 ). Ни один из других путей не показал значительных различий. (D) У мутанта была снижена регуляция каждого из генов ToothCODE TGF-β.Планки погрешностей - SE среднего. (E) Ранее описанный набор генов с повышенной регуляцией в нише стволовых клеток волосяного фолликула [46] был подавлен у мутантов Bmp6 ( P = 8,5 x 10 −12 ). hfSC = стволовые клетки волосяного фолликула (F) Гены сигнатуры стволовых клеток волосяного фолликула, демонстрирующие значительную подавленную экспрессию в мутантах Bmp6 . См. Файл S1 для получения информации об уровнях экспрессии генов и наборах генов. Для B, C и E наборы генов со значительными различиями в экспрессии между диким типом и мутантом указаны красным цветом и звездочкой.

https://doi.org/10.1371/journal.pgen.1007449.g006

Чтобы проверить, регулирует ли колюшка Bmp6 гены-мишени BMP, обнаруженные в других системах, мы сравнили гены, которые по-разному экспрессировались между дикими типами и мутантами, с три разных набора данных, два из ToothCODE [8] и третий из исследования микрочипов [36]. Объединив литературный анализ опубликованных исследований развития зубов у мышей, а также их собственный функциональный анализ, проект ToothCODE собрал список генов-мишеней ниже передачи сигналов BMP в развивающемся эпителии или мезенхиме зубов [8].Мы проверили, были ли ортологи этих эпителиальных и мезенхимальных целевых генов BMP по-разному затронуты в ткани зубной пластинки Bmp6 мутантной колюшки. Ортологи мезенхимальных генов-мишеней BMP в целом демонстрировали значительно сниженную экспрессию у мутантов Bmp6 ( P = 1,25 x 10 -2 ), в то время как ортологи эпителиальных генов-мишеней BMP не были существенно затронуты (рис. 6B). Третий набор генов-мишеней передачи сигналов BMP был идентифицирован в метаанализе опубликованных исследований на микроматрицах [36].Затем мы спросили, значительно ли подавлена ​​регуляция ортологов колюшки этого набора генов в мутантной ткани зубной пластинки Bmp6 . Мы обнаружили, что этот набор ортологов был значительно подавлен у мутантов Bmp6 ( P = 3,12 x 10 -4 ), при этом 15/17 демонстрировали более низкую среднюю экспрессию (рис. 6B). Эти результаты показывают, что колюшка Bmp6 необходима для регуляции консервативной батареи BMP-чувствительных генов.

Мы предположили, что фенотип номера зубов Bmp6 может быть результатом изменений основных сигнальных путей, которые, как известно, участвуют в развитии зубов [6,7].В рамках проекта ToothCODE вручную был составлен список генов, участвующих в развитии зубов в восьми основных сигнальных путях (BMP, FGF, SHH, Wnt, Activin, TGF-β, Notch и EDA), важных для развития зубов у мышей [8]. Мы спросили, были ли гены колюшки, аннотированные как находящиеся в каждом из этих путей, согласованно по-разному экспрессировались в мутантах Bmp6 по сравнению с дикими типами. Мы обнаружили, что сигнальный путь TGF-β значительно подавлен ( P = 4,7 x 10 -3 ) в мутантных зубных пластинах Bmp6 (рис. 6C).Поразительно, что все восемь протестированных компонентов TGF-β имели пониженную среднюю экспрессию в мутантных зубных пластинах Bmp6 и (фиг. 6D). Напротив, ни один из других семи сигнальных путей не имел значительных различий в экспрессии (Рис. 6C), несмотря на различия в количестве зубцов у мутантов Bmp6 . Вместе эти данные указывают на то, что Bmp6 положительно регулирует передачу сигналов TGF-β в ткани зубной пластинки колюшки.

У полифиодонтовых акул, рыб, рептилий и млекопитающих Sox2 участвует в предполагаемых эпителиальных стволовых клетках во время замены зубов [37–39].Мы не обнаружили значительных различий в экспрессии Sox2 между рыбами Bmp6 дикого типа и мутантными рыбами [средние FPKM (количество фрагментов на килобазу транскрипта на миллион отображенных считываний) 91 и 97 соответственно]. У мышей Bmp6 ингибирует пролиферацию стволовых клеток волосяных фолликулов [40,41]. Зубы и волосы представляют собой эпителиальные придатки с глубокой генетической гомологией в развитии [42–45]. Таким образом, мы предположили, что Bmp6 и могут играть консервативную роль в обеспечении покоя стволовых клеток во время замены зубов.Предыдущее исследование охарактеризовало набор генов сигнатуры стволовых клеток волосяного фолликула, которые активируются в нише стволовых клеток в волосяном фолликуле мыши по сравнению с пролиферирующим волосяным зародышем [46]. Мутанты Bmp6 показали очень значимое ( P = 8,5 x 10 -12 ) снижение экспрессии ортологов этих генов колючей (рис. 6E и 6F). Сниженная экспрессия ортологов этих генов сигнатур стволовых клеток волосяных фолликулов подтверждает гипотезу о том, что Bmp6 регулирует покой стволовых клеток во время замены зубов.

Обсуждение

Сопоставление QTL увеличения зуба с интронным энхансером

Bmp6

Мы ранее идентифицировали -цис--регулирующее подавление Bmp6 , связанного с хромосомным 21 зубцом QTL [19]. Поскольку не сообщается об изменениях кодирования между морскими и пресноводными бентосными аллелями Bmp6 у диких колючек [19], регуляторные изменения, которые изменяют пространственно-временной паттерн и / или количественные уровни экспрессии Bmp6 , вероятно, модулируют естественные вариации паттерна зубов.Здесь мы объединили рекомбинантное картирование и сравнительную геномику множественных скрещиваний QTL, чтобы точно сопоставить этот QTL зубца 21 хромосомы с гаплотипом в четвертом интроне Bmp6 . Ассоциация десяти вариантов в интроне 4 Bmp6 с QTL зубца 21 хромосомы, вместе с нашими данными, показывающими, что интрон 4 содержит надежный энхансер зуба, предлагает модель, в которой эти QTL-ассоциированные варианты, по крайней мере, частично лежат в основе QTL зуба. Хотя все QTL-ассоциированные мутации зуба находятся за пределами минимально достаточного 511 bp зубного энхансера, мы предполагаем, что некоторые или все эти варианты лежат в основе cis -регуляторных изменений в Bmp6 .Один из наиболее важных вопросов для будущих исследований заключается в том, влияют ли эти десять вариантов на пространственно-временные паттерны и / или количественные уровни активности энхансеров (таблица 1, столбец 7). Хотя сравнение морских и бентосных конструкций размером ~ 1,3 т.п.н. на сегодняшний день не выявило очевидных различий на ранних эмбриональных и личиночных стадиях, ряд технических проблем, включая мозаицизм в F 0 s и эффекты положения в стабильных линиях, затрудняют сравнение двух энхансеров у разных рыб.Из-за динамических и сложных паттернов экспрессии интронного энхансера устранение потенциальных различий между морскими и бентосными энхансерами может быть облегчено за счет более совершенных инструментов для точного сравнения активности энхансера либо в том же сайте интеграции с использованием посадочных площадок для трансгена, либо у тех же рыб с использованием бицистронных конструкции разделены изолятором.

Отметим, что минимально достаточный энхансер 511 зубов содержит предсказанный сайт связывания Foxc1 [47]. У мышей Foxc1 регулирует регенерацию волос у млекопитающих частично посредством регуляции передачи сигналов BMP и, по-видимому, непосредственно регулирует Bmp6 [48], поэтому потенциальные входы FoxC в экспрессию Bmp6 в замещающих зубах особенно интригуют.Из морских / пресноводных различий в энхансере один SNP изменяет предсказанный сайт связывания NFATc1, критический регулятор покоя стволовых клеток в нише стволовых клеток волосяного фолликула мыши [49]. Другой SNP влияет на предсказанный сайт связывания Gli, представляющий интерес, потому что экспрессия Gli наблюдается во множественных нишах стволовых клеток эпителиальных придатков у мышей [50]. В будущих экспериментах будет проанализировано, какие сигналы регулируют этот интронный энхансер, а также какие фенотипические последствия, если таковые имеются, возникают в результате мутаций в этом энхансере.

Этот интронный энхансер, как и энхансер 5 ’зуба [33], также управляет экспрессией эмбрионов и личинок в развивающихся грудных и срединных плавниках. Одна интересная гипотеза, поднимаемая этими доменами экспрессии в плавниках, заключается в том, регулируются ли эволюционирующие различия в морфологии срединных или грудных плавников с помощью этого производного интронного гаплотипа. Возможно, подтверждая эту гипотезу, QTL, регулирующий морфологию срединного плавника (длина спинного шипа 3), был ранее картирован в широкой области хромосомы 21, перекрывающейся Bmp6 [32].В будущих экспериментах также будет проверяться, имеют ли морские и пресноводные версии усилителя разную активность в плавниках.

Регулировка

Bmp6 во время развития и замены зубов

Наши трансгенные анализы показывают, что интронный энхансер Bmp6 управляет как перекрывающимися, так и отдельными доменами экспрессии, как ранее охарактеризованный энхансер 5 ’ Bmp6 [33]. Оба энхансера вызывают перекрывающуюся экспрессию в мезенхимальных ядрах развивающихся зубов.Однако, по сравнению с 5 ’энхансером, интронный энхансер также, по-видимому, управляет более глубокой и широкой мезенхимальной экспрессией и более ограниченной эпителиальной экспрессией. Эти различия в паттернах экспрессии от двух энхансеров предполагают, что разные входные сигналы контролируют мезенхимальную и эпителиальную экспрессию Bmp6 в развивающихся зубах. Наше открытие, что 5 ’и интронные энхансеры Bmp6 управляют частично неперекрывающимися паттернами экспрессии, напоминают мышиный ген Bmp5 , который имеет два реберных энхансера, которые управляют экспрессией в значительной степени комплементарными паттернами [51].Модульная cis -регуляторная архитектура, вероятно, является общей чертой генов Bmp и может предрасполагать эти гены к частому использованию в морфологической эволюции [21,52–54].

Необходимые роли для

Bmp6 в выживании, росте и формировании рисунка зубов

Этот QTL приводит к позднему действию (стадия молоди, длина рыбы> 25 мм) увеличение числа зубов и размера зубного поля, а также уменьшение расстояния между зубами [19]. Здесь мы получили рыб с индуцированными мутациями в Bmp6 , чтобы напрямую проверить, играет ли Bmp6 какую-либо необходимую роль в регуляции формирования зубного рисунка.Поразительно, что рыбы, гетерозиготные по индуцированным мутациям в Bmp6 , также имели поздние различия в развитии в количестве зубов и размере поля зубов, сходные с QTL зуба (Table 1). Второе фенотипическое сходство между QTL зуба и индуцированными мутациями в Bmp6 - более сильное влияние на количество вентральных зубов, чем на количество дорсальных зубов [19,32]. Однако направление регулирующего аллеля цис , в котором высокозубчатый аллель приводит к снижению экспрессии Bmp6 в цис по сравнению с морским аллелем [19], может предсказывать, что мутация, которая снижает уровни мРНК Bmp6 д. увеличить число зубцов, тогда как мутанты, кодирующие Bmp6 , имеют меньше зубов (Таблица 1).Одним из объяснений этого неожиданного направления эффекта может быть пороговый эффект: мутации Bmp6 были сделаны в пресноводном бентосном генетическом фоне с уже сниженными уровнями экспрессии Bmp6 , и дальнейшее снижение активности Bmp6 могло ингибировать развитие зубов. Одним из тестов этой модели может быть анализ роли Bmp6 во время развития зубов у морской колюшки или в других пресноводных популяциях, лишенных бентосного интронного гаплотипа Bmp6 , описанного здесь.Альтернативно, индуцированные мутантные кодирующие аллели Bmp6 могут не повторять эволюционировавших cis -регуляторных различий между морскими и пресноводными рыбами. Динамическая экспрессия Bmp6 в зубном эпителии и мезенхиме на разных стадиях развития зуба контролируется по крайней мере двумя разными цис -регуляторными элементами ([33]; это исследование), которые, как мы показываем здесь, управляют экспрессией на некоторых стадиях развития зубов. неперекрывающиеся узоры. Эволюционировавший цис -регуляторный аллель Bmp6 может изменять пространственно-временной паттерн и / или уровни мРНК Bmp6 в различных тканях, приводя к фенотипам, отличным от кодирующих мутаций.Индуцирование мутаций потери функции в двух известных энхансерах колюшки Bmp6 и оценка потенциальных изменений в структуре зубов может проверить эту гипотезу.

Гипотеза цис -регулирующая предполагает, что морфологическая эволюция обычно происходит через -цис- -регуляторные мутации, которые избегают отрицательной плейотропии, типичной для кодирующих мутаций [1,2,55]. Недавние исследования показали, что cis -регулирующие и кодирующие мутации могут управлять морфологической эволюцией, и что тип мутации может зависеть от степени плейотропии интересующего гена [18,19,56,57].Летальность и меньший размер рыб, гомозиготных по кодирующим мутациям Bmp6 , может объяснить, почему cis -регуляторные изменения Bmp6 использовались для увеличения числа зубов.

Не было значительных различий в структуре зубов на ранних стадиях развития между диким типом и гетерозиготными мутантными рыбами Bmp6 . Однако по мере того, как эти гетерозиготные рыбы продолжали развиваться до взрослых стадий, когда вновь образующиеся зубы, вероятно, являются замещающими зубами, уменьшение числа зубов и площади зубной пластинки стало более значительным, что позволяет предположить, что развитие зубов на поздних стадиях более чувствительно к дозе БМП6 .Эти различия могут быть следствием различных онтогенетических или генетических ограничений на ранних ювенильных и поздних взрослых стадиях формирования зубного рисунка. Напр., Может быть больше функциональной избыточности Bmp6 с другими лигандами BMP в зубах на ранних стадиях развития, что компенсируется у гетерозиготных мутантов Bmp6 . С другой стороны, эти различия могут означать различную роль Bmp6 в формировании первичных и замещающих зубов: позже развивающиеся замещающие зубы могут быть более чувствительными к дозе Bmp6 , чем молочные зубы.Однако гомозиготные мутанты имели значительно меньше зубов на ранних ювенильных стадиях, предполагая, что Bmp6 также требуется для образования молочных зубов.

Нижестоящие цели передачи сигналов

Bmp6 в ткани зуба

Чтобы проверить, какие гены и пути находятся ниже передачи сигналов Bmp6 и , мы использовали RNA-seq для сравнения полногеномных профилей транскрипции зубных пластин дикого типа и гомозиготного мутанта Bmp6 . Семь сигнальных путей существенно не различались в этом контрасте, что, возможно, удивительно, учитывая предсказанное различие в общем количестве зубов в этих образцах.Однако мы обнаружили, что существует согласованное подавление компонентов сигнального пути TGF-β у гомозиготных мутантов. Передача сигналов TGF-β необходима для развития зубов [58–60]. Более того, передача сигналов TGF-β регулирует экспрессию Bmp6 и в зубах колюшки посредством ранее описанного 5 ’зубного усилителя [33]. Эти результаты подтверждают, что передача сигналов TGF-β участвует как выше, так и ниже Bmp6 во время развития зубов.

Во время развития зубов у мышей реципрокные сигнальные события с участием Bmp4 и Msx1 происходят между развивающимся эпителием зуба и мезенхимой: Bmp4 экспрессия сначала обнаруживается в зубном эпителии, требуется для индукции экспрессии Msx1 в подлежащей мезенхиме, которая в свою очередь необходим для индукции экспрессии Bmp4 и в дентальной мезенхиме [11,61–63].Таким образом, Bmp4 , как полагают, играет критическую роль во время развития зубов как в зубном эпителии, так и в мезенхиме. Большое исследование экспрессии генов на мышах выявило наборы генов, регулируемых с помощью Bmp2 / 4/7 в зубном эпителии и мезенхиме [8]. Мы предположили, что BMP мыши и колюшка Bmp6 регулируют консервативный набор нижестоящих генов в развивающихся зубах. Мы проверили эту гипотезу, задав вопрос, регулируются ли ортологи известных генов-мишеней передачи сигналов BMP мыши по-разному в мутантной ткани зубной пластинки колюшки Bmp6 .Неожиданно мы обнаружили значительно сниженную экспрессию набора генов, ответственных на передачу сигналов BMP в зубных мезенхимальных клетках мышей, в то время как набор генов, реагирующих на передачу сигналов BMP в зубных эпителиальных клетках мышей, существенно не изменился. Возможно, это согласуется с относительно меньшим воздействием на зубной эпителий, чем мезенхима у мутанта Bmp6 , Sox2 , участвующего в эпителиальных стволовых клетках во время замены зубов у др. Полифиодонтов [37-39], не был существенно затронут у мутантов Bmp6 .

Возможные параллели между регенерацией зубов и волос

Предполагается, что у других позвоночных, перенесших замену зубов, зубные стволовые клетки опосредуют замену зубов [37–39,64–66]. Зубы развиваются из плакод, временных утолщений эпителия, которые растут наружу или внутрь и образуют эпителиальные придатки [42,43]. Зубы в своем развитии глубоко гомологичны другим органам, происходящим из плакод, таким как волосы млекопитающих [44,45,67]. Волосы млекопитающих, как и рыбьи зубы, постоянно меняются на протяжении всей взрослой жизни.Во время регенерации волос у млекопитающих Bmp6 регулирует покой стволовых клеток в нише стволовых клеток волосяного фолликула [40,46]. Кроме того, условный нокаут BMP рецептора Bmpr1a в волосяных фолликулах мыши приводил к потере генов регенерации волос и сигнатур стволовых клеток [46]. Таким образом, мы предположили, что колюшка Bmp6 может регулировать сходные генетические пути во время замены зубов, как и во время регенерации волос. Подтверждая эту гипотезу, в ткани зубной пластинки мутанта Bmp6 мы обнаружили значительное подавление сигнатурных генов стволовых клеток волосяных фолликулов мыши, набора генов, которые, как было описано ранее, активируются в стволовых клетках волосяных фолликулов мыши по сравнению с клетками в формирующемся зачатке волоса. [46].Этот результат подтверждает модель, в которой модуляция экспрессии Bmp6 у производных пресноводных колючек изменяет динамику зубных стволовых клеток, что приводит к повышенной частоте замещения зубов, наблюдаемой у высокозубых пресноводных колючек [26]. Более того, этот результат предполагает, что генетическая схема, регулирующая покой стволовых клеток в постоянно регенерирующих волосах млекопитающих, может быть общей во время постоянной замены зубов у рыб. Этот общий набор генов может отражать древний высококонсервативный путь, регулирующий регенерацию эпителиальных придатков позвоночных.Если это так, дальнейшая идентификация этой основной регуляторной сети консервативных генов дала бы глубокое понимание развития, регенерации и эволюции позвоночных.

Методы

Заявление об этике

Все эксперименты на животных (включая эвтаназию путем погружения в буферный раствор трикаинметансульфоната 250 мг / л) были проведены с одобрения Институционального комитета по уходу и использованию животных Калифорнийского университета в Беркли (протокол № R330).

Животноводство колюшки

колюшки были выращены в аквариумах емкостью 29 галлонов в ~ 1/10 или океанской воде (3.5 г / л растворимая океаническая соль, 0,4 мл / л NaHCO3) и скармливали живым рассольным креветкам в качестве личинок, затем замороженным дафниям, мотылям и креветкам Mysis в качестве молодых и взрослых особей. Все скрещивания рыб проводились с использованием искусственных удобрений.

Рекомбинантное картирование

Дальнейшие поколения F3-F5 пресноводного Paxton Benthic с помощью морского скрещивания F2 Little Campbell [68] были размножены путем скрещивания рыб, гетерозиготных по морским и бентосным аллелям хромосомы 21 (идентифицированной по гетерозиготности по Stn487 и Stn489).Рекомбинантные рыбы в поколении F4-F5 были идентифицированы с использованием микросателлитных маркеров Stn487 и Stn489, которые фланкируют генетический интервал, окружающий Bmp6 . Для генотипирования ткани хвостового плавника сначала выделяли ДНК путем инкубации в течение 20 минут при 94 ° C, затем переваривали 2,5 мкл 20 мг / мл протеиназы K в буфере для лизиса (10 мМ Трис, pH 8,3; 50 мМ KCL; 1,5 мМ MgCl 2 ; 0,3% Твин-20 0,3% NP-40) в течение часа при 55 ° C, а затем 20 минут при 94 ° C. Один мкл неразбавленной ДНК использовали непосредственно в ПЦР для генотипирования.Как только рекомбинантные рыбы были идентифицированы, рекомбинантные контрольные точки были дополнительно картированы с использованием комбинации микросателлитных маркеров и полиморфизмов длины рестрикционных фрагментов (RFLP). Последовательности праймеров для левого и правого маркеров, используемых для уточнения каждой рекомбинантной хромосомы, использованной в этом исследовании, показаны в таблице S1. Содержание генов определяли вручную, аннотируя список предсказанных Ensembl генов.

Рекомбинантных рыб скрестили с рыбами F4-F5, гетерозиготными по морской и бентосной хромосоме 21, которые также произошли от тех же бабушек и дедушек F2.События рекомбинации в скрещиваниях 1–3 происходили между маркерами Stn488 и Stn489 (перекрестие 1) или между маркерами Stn487 и Stn488 (перекрестки 2 и 3). Генотипы хромосомы 21 в этих трех скрещиваниях были оценены как M (морские), B (бентосные) или R (рекомбинантные) на основе двух генотипов локуса Stn488 / Stn489 (перекрест 1) или Stn487 / Stn488 (скрещивания 2 и 3). .

Рекомбинантные кроссы были увеличены до стандартной длины ~ 30 мм. Рыб окрашивали кость ализариновым красным, очищали и определяли количество глоточных зубов, как описано ранее [19].Если количество зубов значимо коррелировало со стандартной длиной, полом или семейством рыбы, мы вносили поправки для каждой из них, используя линейную модель, и использовали остатки этой регрессии для статистического анализа (таблица S1). Чтобы проверить, содержит ли каждая рекомбинантная хромосома номер зуба QTL, мы выполнили тест отношения правдоподобия, сравнив две модели, одну с рекомбинантной хромосомой, ведущей себя как бентосную хромосому, и одну с рекомбинантной хромосомой, ведущей себя как морская хромосома.

Бентос на морской F2 пересекает

Выращенные в лаборатории стада бентосных рыб Пакстон, использованные для скрещиваний F2, были получены путем скрещивания рыб дикого происхождения из бентосного озера Пакстон, Британская Колумбия.Пять донных рыб были скрещены с морскими рыбами, а F1s впоследствии скрещены с образованием шести кроссов F2. Специфика морских популяций, используемых в каждом скрещивании, представлена ​​в таблице S2. Были генотипированы три микросателлитных маркера, охватывающих QTL зубца 21 хромосомы: CM1440 (последовательности праймеров от 5 ’до 3’: AAATGTGCTCCTGGATGTGC и CTTTCTCCTTCTGCCAAACG), Stn489 и Stn488; этот набор генотипов был использован для определения молекулярно различных хромосом 21. F2 скрещивает 5 и 6 с бентосными бабушкой и дедушкой. Этот анализ маркеров предполагает, что у пяти донных бабушек и дедушек есть восемь молекулярно различных хромосом 21.

Чтобы определить влияние хромосомы 21 на количество зубов, кроссы F2 были генотипированы с использованием микросателлитных маркеров на хромосоме 21 рядом с QTL зуба (подробности см. В таблице S2). Влияние размера рыбы на количество зубов было устранено с помощью линейной регрессии, а остатки были обратно преобразованы в среднюю стандартную длину рыбы в каждом скрещивании. Статистическая ассоциация между генотипом 21 хромосомы и фенотипами с обратной трансформацией была протестирована с использованием ANOVA в R. Чтобы определить, влияют ли обе бентосные хромосомы на количество зубов в каждом скрещивании, мы выполнили тест отношения правдоподобия для каждой дикой бентосной хромосомы, сравнивая модель. где эта хромосома не влияет на количество зубов в модели, где обе бентосные хромосомы одинаково влияют на количество зубов.

Последовательности генома морской и донной колюшки

Мы пересеквенировали геномы четырех донных бабушек и дедушек от скрещивания 1–4 и рыб F2, гомозиготных по хромосоме B 7 и B 8 . Мы также секвенировали морских бабушек и дедушек Литтл Кэмпбелл из скрещивания 5–6 и японских морских бабушек и дедушек из скрещивания 3 (рис. 2). Хвостовые плавники переваривали в течение ночи при 55 ° C в буфере для расщепления хвоста (10 мМ Трис, pH 8,0, 100 мМ NaCl, 10 мМ EDTA, pH 8,0, 0.5% SDS, 10 мкл 20 мг / мл протеиназы K). Геномную ДНК очищали экстракцией фенол: холороформ с последующим осаждением этанолом. Геномные библиотеки были созданы с использованием набора для подготовки образцов ДНК Nextera (Epicenter Biotechologies), набора для подготовки образцов ДНК Nextra (Illumina) или набора для подготовки библиотеки ДНК Nextera XT (Illumina). Считывания с парных концов (100 п.н.) секвенировали с использованием Illumina HiSeq2000. См. Таблицу S3 для получения подробной информации о подготовке библиотеки и сводке по секвенированию для каждой библиотеки.

Обозначение варианта и идентификация варианта для конкретного зуба

Полученные считывания были сопоставлены с повторяющейся замаскированной версией эталонного генома колюшки [24] с использованием модулей bwa aln и bwa sampe выравнивателя Burrows-Wheeler [69]. Поскольку сборки генома в минимальном мейотическом интервале 884 т.п.н. идентичны в Jones et al. и Glazer et al. сборки [24,70], исходный Jones et al. использовалась сборка [24]. Samtools (версия 0.1.17) [71] использовался для создания отсортированного и индексированного файла BAM, а инструменты Picard (версия 1.51) (http://broadinstitute.github.io/picard/) использовался для исправления информации о спаривании, добавления групп чтения и удаления дубликатов ПЦР. Унифицированный генотип GATK (параметры: '—genotype_likelihoods_model INDEL', '-stand_call_conf 25' и '-stand_emit_conf 25') RealignerTargetCreator, IndelRealigner (параметр: '-LOD 0.4') использовался для вызова потенциальных отступов цели и выполнения переназначения. Повторная калибровка базового качества была выполнена с помощью BaseRecalibrator. HaplotypeCaller (параметры: '-emitRefConfidence GVCF', '—variant_index_type LINEAR' и '—variant_index_parameter 128000') использовался для создания файла геномного VCF (gVCF) для каждой библиотеки.Полученные gVCF были объединены, и варианты были вызваны с использованием модуля GenotypeGVCFs [72–74]. Варианты высокого качества были отобраны с использованием следующих критериев: 1) Варианты должны иметь показатель качества варианта выше 400. 2) Варианты не должны называться «отсутствующими» или иметь показатель качества менее 10 в любом бентосном геноме с высоким охватом. 3) Варианты не должны называться «отсутствующими» или иметь оценку качества менее десяти не более чем в двух геномах. Для дальнейшего удаления повторов, специфичных для колюшки, мы удалили варианты с> 99% фланкирующей последовательности размером 100 п.н., соответствующей более чем шести местам в геноме, используя blastn с e-значением менее 1x10 -30 [75].Оценка согласованности QTL - это абсолютное значение доли случаев, когда вариант присутствовал у донных рыб с QTL с зубцом 21 хромосомы, за вычетом доли случаев, когда такой же вариант был обнаружен у рыб без QTL с зубцом. Оценки соответствия QTL были рассчитаны с использованием специального скрипта Python.

Получение трансгенных энхансерных линий колюшки

Для создания репортерных конструкций GFP каждый из фрагментов интрона 4 морского прародителя Little Campbell из скрещивания 5 был клонирован перед промотором Hsp70l в конструкции экспрессии Tol2 с использованием Nhe I [33].Для конструкции mCherry мы клонировали mCherry в репортерную конструкцию Hsp70l с использованием Sal I и Cla I, и вставки были клонированы выше с использованием Nhe I и BamH I. Показаны праймеры для создания конструкции и секвенирования. в таблице S5.

Для создания трансгенной колюшки, информационная РНК транспозазы была синтезирована из плазмиды pCS2-TP [76], линеаризованной с помощью Not I, и транскрибирована с использованием набора для транскрипции mMessage SP6 in vitro (Ambion) и очищена с использованием колонки Qiagen RNeasy.Одноклеточным эмбрионам морской колюшки вводили смесь 37,6 нг / мкл плазмидной ДНК и 75 нг / мкл РНК с 0,05% фенолового красного, как описано ранее [33]. Все представленные изображения трансгена получены из стабильных линий, за исключением экспрессии mCherry на фиг. 4I и 4J и фрагмента размером ~ 2kb на фиг. S1 (которые были мозаичными).

Создание конструкции TALEN для нацеливания на колючку

Bmp6

Для создания пары TALEN, нацеленной на ген колюшки Bmp6 , мы использовали TAL эффекторный нуклеотид-мишень 2.0 (https://tale-nt.cac.cornell.edu/node/add/talen)) для сканирования второй последовательности экзона Bmp6 на предмет потенциальных сайтов-мишеней [77,78]. Мы выбрали параметры TALEN, как описано в [34]. Мы выбрали сайт-мишень, который является уникальным для Bmp6 в геноме колюшки и содержит общий сайт рестрикции EcoR I, который можно использовать для обнаружения молекулярных делеций. Мы собрали две конструкции TALEN, используя клонирование Golden Gate в целевые векторы pCS2TALDD и pCS2TALRR, и проверили правильность сборки, используя секвенирование по Сэнгеру, как описано [34].См. Таблицу S6 для получения информации о конструкции Bmp6 TALEN.

Синтез и введение TALEN РНК в эмбрионы колюшки

5'-кэпированных мРНК для каждой пары TALEN транскрибировали с использованием SP6 mMessage Machine (Ambion) после линеаризации плазмидных матриц TALEN с помощью Not I. Объединенную мРНК TALEN вводили в одноклеточные пресноводные эмбрионы бентосной колюшки PAXB при концентрация 40 нг / мкл для каждой мРНК с 0,05% фенолового красного.

Идентификация мутации Талена

Чтобы генотипировать рыбу на предмет мутаций, индуцированных TALEN, ДНК экстрагировали, как описано выше, из ткани хвостового плавника взрослой рыбы или гомогенизированных целых эмбрионов 1–3 dpf.ПЦР для генотипирования выполняли с использованием прямого праймера 5’-ACAAGCCGCTAAAAAGGACA-3 ’и обратного праймера 5’-GCACGTGTGCATGCTTTAGA -3’. Профиль реакции для реакции NEB Phusion был 98 ° C в течение 30 секунд, 39 циклов 98 ° C в течение 10 секунд, 58 ° C в течение 15 секунд, 72 ° C в течение 30 секунд, а затем 72 ° C в течение 10 минут. Продукты ПЦР были разрезаны непосредственно с помощью EcoR I. Продукты из аллелей дикого типа и мутантных аллелей вырезали и не разрезали, соответственно, с помощью этого анализа (см. S3 фиг.).

Количественная оценка рисунка зуба

Число дорсальных и вентральных глоточных зубов определяли на микроскопе DM2500 Leica с использованием фильтра TX2, как описано ранее [19].Для количества вентральных и дорсальных зубов общее количество зубов равно сумме левой и правой сторон (вентральных и дорсальных глоточных зубов соответственно). Площадь зубной пластинки и расстояние между вентральной пластиной глотки и зубной пластиной определяли количественно по серому изображению, полученному камерой DFC340 FX на Leica M165FC, как описано ранее [19]. Площадь и расстояние между вентральными пластинами глотки являются средними значениями для левой и правой зубных пластин. Характеристики скелета были разделены по общей длине рыбы для трех стадий: ранняя молодь <27 мм, поздняя молодь 27–37 мм и имаго> 37 мм.

Очистка, секвенирование и выравнивание РНК

Вентральные зубные пластинки от трех гомозиготных мутантов дикого типа (по аллелю с делецией 13 п.н.) Bmp6 самок колюшки (стандартная длина ~ 25 мм) препарировали, помещали в реагент TRI (Sigma-Aldrich) на льду, измельчали ​​с помощью одноразовый пестик и замораживают на ночь при -80 ° C. На следующий день РНК экстрагировали, осаждали изопропанолом и ресуспендировали в воде, обработанной DEPC. 200 нг очищенной РНК использовали с Truseq Stranded mRNA Library Prep Kit от Illumina для создания библиотек секвенирования.Полученные библиотеки штрих-кодов были объединены, и были сгенерированы парные считывания по 100 п.н. с использованием одной дорожки Illumina HiSeq2000. Считывания были сопоставлены с эталонным геномом колюшки [24] с использованием STAR (параметры: '—alignIntronMax 200000' '—alignMatesGapMax 200000' '—outFilterMultimapNmax 8') [79]. Файлы BAM были созданы, отсортированы и проиндексированы с помощью Samtools (версия 0.1.17) [71]. Инструменты Picard (версия 1.51) использовались для исправления информации о сопряжении, добавления групп чтения и удаления дубликатов ПЦР (http: // broadinstitute.github.io/picard/). Используя эталонный транскриптом Ensembl [24], транскрипты были количественно определены с использованием cuffquant версии 2.2.1 (параметры: '-u' '—library-type fr-firststrand') и нормализованы с использованием cuffnorm [80,81]. Анализ основных компонентов полученного количества транскриптов был проведен с использованием пакета PCA FactoMineR (http://factominer.free.fr/index.html) в R, и был нанесен на график обогащения терминов R. GO для генов, ранжированных по корреляции экспрессии с первый главный компонент матрицы экспрессии RNAseq был выполнен с использованием GOrilla [82,83].Иерархическая кластеризация выполнялась с помощью Cluster3.0 (параметры: '-l' '-cg a' '-g 2' '-e 0' '-m c') [84], а результаты визуализировались с помощью JavaTreeView (версия 1.1 .6r4) [85]. Дополнительные рисунки и анализ были выполнены с использованием пользовательских скриптов Python и рисунков, созданных с помощью matplotlib.

Обогащенный анализ генетического набора

Наборы генов

ToothCODE были загружены из базы данных ToothCODE (http://compbio.med.harvard.edu/ToothCODE/). ToothCODE идентифицировал нижестоящие мишени передачи сигналов Bmp с помощью манипуляций с анализом литературы Bmp2 , Bmp4 и Bmp7 .Мишени, которые активировались, когда передача сигналов BMP увеличивалась, или подавлялись, когда передача сигналов BMP была снижена, были названы генами-мишенями BMP. Ортологи колючек сигнатурных генов стволовых клеток волосяного фолликула, гены, активируемые в выпуклости волосяного фолликула относительно волосяного зародыша [46], были идентифицированы с использованием прогнозов Ensembl. Статистическое обогащение выполнялось аналогично методам, описанным ранее [86]. Каждый ген в наборе подвергался t-тесту, получая список z-значений. Нулевая гипотеза о том, что набор генов не показывает обогащения дифференциальной экспрессии, (т.е. t-критерий (z-значения взяты из стандартного нормального распределения) был протестирован с использованием t-критерия для 1 выборки, с полученными значениями P с поправкой Бонферрони. Порог значимости для t-критерия с 1 выборкой был подтвержден путем создания моделируемого нулевого распределения с использованием 10 000 перестановок равного количества генов, как в каждом наборе генов, выбранных случайным образом без замены. Статистические значения критерия отсечки были выбраны путем взятия значений в перцентиле 100- (2,5 / N) и 2,5 / N в моделированном нулевом распределении, где N - количество проверяемых гипотез.Анализ проводился с использованием набора пользовательских скриптов Python, доступных по запросу.

Вспомогательная информация

S1 Рис. Область интрона 4 размером 2 т.п.н. является энхансером, активным в развитии плавников и зубов.

(A) Морской интронный энхансер размером ~ 2 т.п.н. приводил к экспрессии со скоростью 8 dpf в дистальных краях развивающегося срединного плавника (стрелка) и грудного плавника (наконечник стрелки). (B-C) На 10 dpf энхансер стимулировал экспрессию GFP в мезенхиме зуба (стрелка) и диффузно в эпителии зуба (наконечники стрелок) в глотке (B) челюстей.Экспрессия GFP также была обнаружена в развивающихся зубных зачатках (стрелка) в оральной (C) челюсти. В B-C кость контрастирует с красной флуоресценцией ализариновым красным. B - вид сверху рассеченной вентральной глоточной челюсти, а C - вид сбоку с передней левой стороны верхней челюсти (верхняя челюсть, верхняя челюсть) и нижней челюсти (зубной, нижний). (D) Этот энхансер размером ~ 2 kb контролирует динамическую экспрессию на протяжении всего развития, становясь более ограниченным мезенхимой по мере созревания зуба. Масштабные линейки составляют 100 мкм (A-C) и 50 мкм (D).

https://doi.org/10.1371/journal.pgen.1007449.s001

(TIF)

S2 Рис. Эффективность

Bmp6 TALEN на эмбрионах колюшки.

(A) Частоты эмбрионов дикого типа (+ / +), гетерозиготных (+/-) и гомозиготных (- / -) мутантов F 0 , инъецированных через 3 дня после оплодотворения (dpf), показаны для трех независимых инъекционные раунды. (B) Сайт EcoR I был разрушен индуцированными мутациями. Показаны репрезентативные анализы расщепления EcoR I на ПЦР-ампликоне из геномной ДНК гомозиготного эмбриона дикого типа (слева, + / +), гетерозиготного (в центре, +/-) и гомозиготного мутанта (справа, - /).

https://doi.org/10.1371/journal.pgen.1007449.s002

(TIF)

S3 Рис. Прогнозируемые аминокислотные выравнивания дикого типа, делеция 13 п.н. и аллели BMP6 с делецией 3 п.н. / вставкой 4 п.н.

Предсказанные мутантные последовательности BMP6, делеция 3 bp / вставка 4 bp (в центре) и делеция 13 bp (внизу), выровненные с последовательностью BMP6 дикого типа (вверху). Делеция 13 п.н. и делеция 3 п.н. + вставка 4 п.н. генерируют сдвиги рамки, которые приводят к преждевременным стоп-кодонам (отмеченным звездочкой) в 2 экзонах и 3 экзонов, соответственно, которые, как предполагается, усекают белок.Последовательности BMP6 дикого типа и границы интронов / экзонов (отмечены стрелками) были описаны ранее [19]. Отмечено положение сайта EcoR I, используемого для анализа генотипирования.

https://doi.org/10.1371/journal.pgen.1007449.s003

(TIF)

S4 Рис.

Bmp6 Эффект мутации на дорсальные глоточные зубы.

(A) Скорректированное по размеру количество глоточных зубов на дорсальной зубной пластине 1 (DTP1) существенно не различается между гомозиготными мутантными (красная), гетерозиготными (фиолетовыми) и гомозиготными (синими) рыбами дикого типа на любой стадии.(B) Число зубов на дорсальной зубной пластине 2 (DTP2) было значимым только на взрослой стадии (ANOVA P = 0,028) в отличие от результатов вентральных глоточных зубов (VTP) (см. Фиг.5).

https://doi.org/10.1371/journal.pgen.1007449.s004

(TIF)

S1 Таблица. Резюме рекомбинантных скрещиваний.

Размеры образцов морских рекомбинантных скрещиваний Paxton benthic x Little Campbell показаны вместе с последовательностями праймеров для левых и правых маркеров генотипирования, используемых в качестве границ для точки разрыва рекомбинации.Маркеры для рекомбинантных 1 и 2 представляют собой полиморфизмы размеров, а маркеры для рекомбинантных 3 представляют собой полиморфизмы длины рестрикционных фрагментов (ПДРФ) с использованием указанной рестрикционной нуклеазы. При необходимости были скорректированы стандартные длина и пол рыбы, и перечислены исправления, выполненные для каждого скрещивания. Для каждого левого и правого маркера указаны левая и правая позиции в парах оснований, соответственно, на хромосоме 21 в сборке генома колюшки [24].

https://doi.org/10.1371/journal.pgen.1007449.s005

(PDF)

S2 Таблица. Сводка по кроссу Benthic x marine F2.

Результаты тестирования восьми бентосных хромосом при скрещивании морских организмов с помощью бентосных F2. Перечислены популяции, количество рыб F2 и маркер 21 хромосомы, генотипированные для каждого скрещивания. PAXB = бентосный пакстон, JAMA = морской пехотинец Японии, RABS = морской карстовый карьер, LITC = морской прибрежный район Литтл-Кэмпбелл. Пол каждой бабушки и дедушки указан в столбце «Популяции, пересекаемые (самец x самка)». Для каждого скрещивания указан наиболее информативный и полностью генотипированный маркер, ближайший к ранее сообщенному пику QTL [19].Влияние стандартной длины на общее количество вентральных глоточных зубов при необходимости корректировалось, а остатки обратно преобразовывались в среднюю стандартную длину рыбы в пределах каждого скрещивания. Средняя и стандартная ошибка исправленного числа зубов показаны для морских гомозигот (MM), гетерозигот (MB) и бентосных гомозигот (BB). Все бабушки и дедушки PAXB были разными рыбами, за исключением дедушки и бабушки скрещивания 5 и 6, который был одним и тем же самцом PAXB. Восемь различных молекулярно различных бентосных хромосом (см. Рис. 2) перечислены в столбце «Проверенные бентосные хромосомы».При скрещивании 1, 3 и 4 тестировались две отдельные бентосные хромосомы, а при скрещивании 2, 5 и 6 тестировалась одна бентическая хромосома. Кресты 1 и 4 имеют общую бентосную хромосому с одними и теми же микросателлитными генотипами (см. Методы). Значения P из ANOVA для проверки того, оказывает ли генотип существенное влияние на фенотип числа зубов, перечислены (см. Рис. 2). В последнем столбце показаны значения P из двух тестов отношения правдоподобия (LR), сравнивающих аддитивную модель с моделью без воздействия бентоса 1 и показаны модели без воздействия бентоса 2.Четыре аллельных маркера, использованные для скрещиваний 1, 3 и 4, были CM1440, Stn223 и CM1440 соответственно. Тесты LR показывают, что обе бентосные хромосомы оказывают значительное влияние на количество зубов в скрещиваниях 1,3 и 4. F2 скрещивания 2, 5 и 6 содержат одну и ту же бентосную хромосому, и, таким образом, в этих скрещиваниях бентосные хромосомы нельзя тестировать по отдельности. (поскольку их нельзя различить на молекулярном уровне). Таким образом, для этих крестов тест LR неприменим (NA).

https://doi.org/10.1371/journal.pgen.1007449.s006

(PDF)

S3 Таблица. Резюме изменения последовательности генома.

Для каждой рыбы, использованной для повторного секвенирования генома, приводится набор для подготовки библиотеки, общее количество считываний, окончательные сопоставленные считывания и предполагаемый охват. LITC, JAMA и PAXB относятся к популяциям Little Campbell Marine, Japanese Marine и Paxton Benthic соответственно. Расчетный охват был рассчитан путем деления окончательных отображенных считываний на размер генома колюшки для каждого образца. Два генома с высоким охватом (> 70 x) каждый секвенировали на полной дорожке, а геномы с более низким охватом кодировали штрих-кодом и мультиплексировали с пятью другими рыбами на дорожку секвенирования.Все секвенирование было 100 п.н. на парных концах на Illumina HiSeq2000.

https://doi.org/10.1371/journal.pgen.1007449.s007

(PDF)

S4 Таблица. QTL-ассоциированные варианты.

«Chr. 21 позиция »указывает положение на хромосоме 21 в сборке эталонного генома колюшки. «Референс» перечисляет генотип в этой позиции в сборке референсного генома [24], тогда как «QTL-связанный вариант» указывает генотип в этой позиции вариантов, согласующихся с наличием или отсутствием зубца QTL (см. Фиг. 3).

https://doi.org/10.1371/journal.pgen.1007449.s008

(PDF)

S5 Таблица. Праймеры для клонирования репортерных конструкций.

Последовательности прямого и обратного праймеров, используемых для клонирования каждой конструкции, перечислены от 5 ’к 3’ вместе с рестрикционным ферментом, используемым для переваривания ПЦР-ампликона. Ориентацию вставок в конструкциях GFP тестировали в отрицательном направлении по отношению к промотору, поскольку эндогенный энхансер расположен 3 ’к промотору Bmp6 в геноме колюшки.Конструкцию mCherry клонировали в положительной ориентации, чтобы отразить ориентацию трансгенной линии 5 ’зубного энхансера, использованной в эксперименте по совместному мечению (см. Фиг.4).

https://doi.org/10.1371/journal.pgen.1007449.s009

(PDF)

S6 Таблица. Индивидуальный дизайн и мишени TALEN.

Повторяющиеся переменные Diresidues ( RVD), используемые для генерации левой (TAL1) и правой (TAL2) пар нуклеаз, нацеленных на второй экзон Bmp6 , и приведена целевая последовательность колюшки.Подчеркнутые нуклеотиды соответствуют мишеням TAL1 и TAL2 длиной 19 пар оснований, фланкированным спейсером длиной 17 пар оснований, содержащим сайт рестрикции EcoR I (жирный шрифт).

https://doi.org/10.1371/journal.pgen.1007449.s010

(PDF)

S7 Таблица.

Bmp6 Выживание класса мутантов и длина рыбы.

Размеры выборки, средняя общая длина рыб и стандартные отклонения для скрещиваний, дающих мутантных рыб дикого типа, гетерозиготных и гомозиготных (скрещивания, вверху) или дикого типа и гетерозигот (обратные скрещивания, внизу).Показаны значения смертности P по критерию хи-квадрат, предполагающему соотношение 1: 2: 1 для перекрестных скрещиваний и соотношение 1: 1 для обратных скрещиваний. Было значительное отклонение от ожидаемого соотношения 1: 2: 1 (вероятно, из-за смертности) в перекрестной кладке C, где рыба была самой крупной. Значения длины P из ANOVA показаны для рецессивной модели (классы дикого типа и гетерозиготные объединены и сравниваются с гомозиготными мутантами). Во всех трех скрещиваниях гомозиготные мутантные рыбы были меньше, чем их гетерозиготные братья и сестры дикого типа.Одно из муфт обратного скрещивания имело значительный размерный дефект, которого не было у другого сцепления. Кресты A, C, D и E содержат аллель с делецией 13 п.н. Кросс B является трансгетерозиготным помесом между рыбой, гетерозиготной по делеции 13 п.н., и рыбой, гетерозиготной по делеции 3 п.н. + вставкой 4 п.н. (см. Таблицу S8).

https://doi.org/10.1371/journal.pgen.1007449.s011

(PDF)

S8 Таблица. Трансгетерозиготные эффекты на формирование рисунка зубов.

Анализ трансгетерозиготного скрещивания, делеция 13bp путем делеции 3bp / вставка 4bp, для фенотипов формирования зубного рисунка.Влияние стандартной длины рыбы было устранено с помощью линейной регрессии для каждого меристического или непрерывного признака. Наблюдались значительные рецессивные различия в классе гомозиготных мутантов по количеству вентральных зубов и площади вентральной зубной пластинки, что согласуется с результатами динамики мутантов. Показаны средние значения непрерывных признаков и стандартные отклонения (показаны в скобках) для каждого генотипического класса вместе со значениями P из апостериорного теста Тьюки.

https://doi.org/10.1371/journal.pgen.1007449.s012

(PDF)

S9 Таблица. Сводная статистика секвенирования РНК.

Общее количество считываний, картированных считываний и стандартная длина рыб указаны для каждой рыбы дикого типа (1–3) и мутантных рыб (4–6), используемых для секвенирования. Все библиотеки были созданы с помощью набора TruSeq Stranded mRNA Library Prep Kit, со штрих-кодом, мультиплексированы и секвенированы с парными концами 100 пар оснований в одной дорожке Illumina HiSeq2000.

https://doi.org/10.1371/journal.pgen.1007449.s013

(PDF)

S10 Таблица.GO-термин обогащение первого основного компонента экспрессии гена.

GO-термин обогащение для списка генов, ранжированных по корреляции экспрессии с первым основным компонентом матрицы экспрессии зубной пластинки дикого типа Bmp6 и мутантной матрицы. Показаны важные члены GO с q-значением FDR менее 1E-04.

https://doi.org/10.1371/journal.pgen.1007449.s014

(PDF)

Благодарности

Мы благодарим Сару Карсанаро, Ицзя Хонг и Энтони Ли за помощь в фенотипическом анализе; Эндрю Глейзеру и Майклу Бронски за помощь в создании некоторых библиотек для повторного секвенирования генома Nextera, Марио Клевсу за статистическую консультацию, а также Дину Эмера и Тайлер Сквер за комментарии к рукописи.

Ссылки

  1. 1. Кэрролл С.Б. Эво-дево и расширяющийся эволюционный синтез: генетическая теория морфологической эволюции. Клетка. 2008. 134: 25–36. pmid: 18614008
  2. 2. Wray GA. Эволюционное значение цис--регуляторных мутаций. Nat Rev Genet. 2007. 8: 206–216. pmid: 17304246
  3. 3. Мартин А., Оргогозо В. Локусы повторной эволюции: каталог генетических горячих точек фенотипической изменчивости.Эволюция. 2013; 67: 1235–1250. pmid: 23617905
  4. 4. Стерн Д.Л., Оргогозо В. Локусы эволюции: насколько предсказуема генетическая эволюция? Эволюция. 2008; 62: 2155–77. pmid: 18616572
  5. 5. Джернвалл Дж., Теслефф И. Формирование формы зубов и обновление зубов: эволюция по одним и тем же сигналам. Разработка. 2012; 139: 3487–3497. pmid: 22949612
  6. 6. Такер А.С., Фрейзер Г.Дж. Эволюция и разнообразие развития регенерации зубов. Semin Cell Dev Biol.2014; 25–26: 71–80.
  7. 7. Катон Дж., Такер А.С. Современные знания о развитии зубов: формирование рисунка и минерализация зубных рядов мыши. J Anat. 2009; 214: 502–515. pmid: 19422427
  8. 8. О’Коннелл DJ, Хо Дж.В.К., Маммото Т., Турбе-Доан А., О’Коннелл Дж. Т., Хэзли П.С. и др. Цепь обратной связи Wnt-bmp контролирует динамику передачи сигналов между тканями в органогенезе зубов. Sci Signal. 2012; 5: ra4. pmid: 22234613
  9. 9. Neubüser A, Peters H, Balling R, Martin GR.Антагонистические взаимодействия между сигнальными путями FGF и BMP: механизм позиционирования участков формирования зубов. Клетка. 1997; 90: 247–255. pmid: 9244299
  10. 10. St Amand TR, Zhang Y, Semina EV, Zhao X, Hu Y, Nguyen L, et al. Антагонистические сигналы между BMP4 и FGF8 определяют экспрессию Pitx1 и Pitx2 в формирующем зуб зачатке мыши. Dev Biol. 2000; 217: 323–332. pmid: 10625557
  11. 11. Bei M, Kratochwil K, Maas RL.BMP4 восстанавливает не клеточно-автономную функцию Msx1 в развитии зубов. Разработка. 2000; 127: 4711–4718. pmid: 11023873
  12. 12. Кавана К.Д., Эванс А.Р., Джернвалл Дж. Предсказание эволюционных паттернов зубов млекопитающих на основе развития. Природа. 2007; 449: 427–32. pmid: 17898761
  13. 13. Андл Т., Ан К., Кайро А., Чу Е.Ю., Вайн-Ли Л., Редди С.Т. и др. Эпителиальный Bmpr1a регулирует дифференцировку и пролиферацию в постнатальных волосяных фолликулах и необходим для развития зубов.Разработка. 2004. 131: 2257–2268. pmid: 15102710
  14. 14. Ван И, Ли Л, Чжэн И, Юань Г, Ян Г, Хе Ф и др. Активность BMP необходима для развития зубов от пластинки до стадии зачатка. J Dent Res. 2012; 91: 690–5. pmid: 22592126
  15. 15. Кингсли DM, Peichel CL. Молекулярная генетика эволюционных изменений колюшек. В: С. Остлунд-Нильссон И.М., Хантингфорд Ф.А., редакторы. Биология трехиглой колюшки. CRC Press; 2007. С. 41–81.
  16. 16.Peichel CL, Marques DA. Генетическая и молекулярная архитектура фенотипического разнообразия колюшки. Philos Trans R Soc Lond B Biol Sci. 2017; 372. pmid: 27994127
  17. 17. Белл М.А., Фостер С.А. Эволюционная биология трехигровой колюшки. Нью-Йорк: издательство Оксфордского университета; 1994.
  18. 18. Чан Ю.Ф., Маркс М.Э., Джонс ФК, Вильярреал Дж., Шапиро, доктор медицины, Брэди С.Д. и др. Адаптивная эволюция сокращения таза у колюшек путем повторяющейся делеции энхансера Pitx1 .Наука. 2010. 327: 302–305. pmid: 20007865
  19. 19. Cleves PA, Ellis NA, Jimenez MT, Nunez SM, Schluter D, Kingsley DM, et al. Развитие зубов у колюшек связано с регулирующим аллелем cis Bmp6 . Proc Natl Acad Sci U S. A. 2014; 111: 13912–13917. pmid: 25205810
  20. 20. Колосимо П.Ф., Хосеманн К.Э., Балабхадра С., Вильярреал Дж., Диксон М., Гримвуд Дж. И др. Распространенная параллельная эволюция колюшек путем многократной фиксации аллелей Ectodysplasin .Наука. 2005; 307: 1928–1933. pmid: 157
  21. 21. Инджеан В.Б., Кингман Г.А., Джонс ФК, Гюнтер Калифорния, Гримвуд Дж., Шмутц Дж. И др. Развитие новых черт скелета с помощью цис - регулирующих изменений в костных морфогенетических белках. Клетка. 2016; 164: 45–56. pmid: 26774823
  22. 22. Миллер С.Т., Белеза С., Пыльца А.А., Шлютер Д., Киттлс Р.А., Шрайвер М.Д. и др. cis - Регуляторные изменения экспрессии лиганда Kit и параллельная эволюция пигментации у колюшки и человека.Клетка. 2007. 131: 1179–1189. pmid: 18083106
  23. 23. О’Браун Н.М., Саммерс Б.Р., Джонс ФК, Брэди С.Д., Кингсли Д.М. Регулярное регуляторное изменение, лежащее в основе измененной экспрессии и ответа Wnt гена панцирных пластин колюшки EDA . eLife. 2015; 4: e05290. pmid: 25629660
  24. 24. Джонс Ф.К., Грабхер М.Г., Чан Ю.Ф., Рассел П., Масели Э., Джонсон Дж. И др. Геномные основы адаптивной эволюции трехиглой колюшки. Природа. 2012; 484: 55–61. pmid: 22481358
  25. 25.Schluter D, Mcphail JD. Экологическое перемещение и видообразование колюшки. Am Nat. 1992; 140: 85–108. pmid: 19426066
  26. 26. Эллис Н.А., Глейзер А.М., Донде Н.Н., Клевес П.А., Агоглия Р.М., Миллер СТ. Определенные генетические механизмы развития лежат в основе конвергентно эволюционировавшего прироста зубов у колюшек. Разработка. 2015; 142: 2442–2451. pmid: 26062935
  27. 27. Мудрый SB, Stock DW. Сохранение и дивергенция паттернов экспрессии Bmp2a, Bmp2b и Bmp4 внутри и между зубными рядами костистых рыб.Evol Dev. 2006; 8: 511–523. pmid: 17073935
  28. 28. Мушик М., Индермор А., Зальцбургер В. Конвергентная эволюция в адаптивной радиации рыб цихлид. Curr Biol. 2012; 22: 2362–8. pmid: 23159601
  29. 29. Фрейзер Дж. Дж., Грэм А., Смит ММ. Консервативное размещение генов во время одонтогенеза у остеихтиев. Proc Biol Sci. 2004. 271: 2311–2317. pmid: 15556883
  30. 30. Фрейзер Дж. Дж., Халси К. Д., Блумквист Р. Ф., Уесуги К., Мэнли Н. Р., Стрелман Дж. Т..Древняя генная сеть кооптирована для зубов на старых и новых челюстях. PLoS Biol. 2009; 7: e31. pmid: 19215146
  31. 31. Джекман WR, Draper BW, Stock DW. Передача сигналов Fgf необходима для развития зубов у рыбок данио. Dev Biol. 2004. 274: 139–157. pmid: 15355794
  32. 32. Миллер CT, Глейзер AM, Саммерс BR, Blackman BK, Norman AR, Shapiro MD, et al. Модульная эволюция скелета колюшки контролируется аддитивными и сгруппированными локусами количественных признаков. Генетика. 2014; 197: 405–420.pmid: 24652999
  33. 33. Эриксон PA, Клевес PA, Эллис NA, Schwalbach KT, Hart JC, Miller CT. Для экспрессии Bmp6 колюшки Bmp6 необходимы 190 пар оснований, TGF-β-чувствительный усилитель зуба и плавника. Dev Biol. 2015; 401: 310–323. pmid: 25732776
  34. 34. Далем Т.Дж., Хошиджима К., Юринек М.Дж., Гюнтер Д., Старкер К.Г., Локк А.С. и др. Простые методы генерации и обнаружения локус-специфичных мутаций, индуцированных TALEN в геноме рыбок данио. PLoS Genet.2012; 8: e1002861. pmid: 22916025
  35. 35. Анкер ГК. Морфология и кинетика головы колюшки, Gasterosteus aculeatus . Trans Zool Soc Lond. 1974; 32: 311–416.
  36. 36. Prashar P, Yadav PS, Samarjeet F, Bandyopadhyay A. Мета-анализ микроматриц идентифицирует эволюционно консервативные цели передачи сигналов BMP в развивающихся длинных костях. Dev Biol. 2014; 389: 192–207. pmid: 24583261
  37. 37. Juuri E, Jussila M, Seidel K, Holmes S, Wu P, Richman J, et al.Sox2 отмечает способность эпителия образовывать зубы у млекопитающих и рептилий. Dev Camb Engl. 2013; 140: 1424–1432. pmid: 23462476
  38. 38. Абдувели Д., Баба О., Табата М.Дж., Хигучи К., Митани Х., Такано Ю. Зубное замещение и предполагаемые ниши одонтогенных стволовых клеток в глоточных зубных рядах медаки (Oryzias latipes). Microsc Oxf Engl. 2014; 63: 141–153. pmid: 24463193
  39. 39. Мартин К.Дж., Раш Л.Дж., Купер Р.Л., Метчер Б.Д., Йохансон З., Фрейзер Дж. Предшественники Sox2 + у акул связывают развитие вкуса с развитием регенеративных зубов из дентикулов.Proc Natl Acad Sci U S. A. 2016; 113: 14769–14774. pmid: 27930309
  40. 40. Blanpain C, Lowry WE, Geoghegan A, Polak L, Fuchs E. Самообновление, мультипотентность и существование двух популяций клеток в нише эпителиальных стволовых клеток. Клетка. 2004. 118: 635–648. pmid: 15339667
  41. 41. Генандер М., Кук П.Дж., Рамскельд Д., Киз Б.Е., Мертц А.Ф., Сандберг Р. и др. Передача сигналов BMP и его гены-мишени pSMAD1 / 5 по-разному регулируют клоны стволовых клеток волосяного фолликула. Стволовая клетка.2014; 15: 619–633. pmid: 25312496
  42. 42. Ан Ю. Сигнализация в плакодах зубов, волос и молочных желез. Curr Top Dev Biol. 2015; 111: 421–459. pmid: 25662268
  43. 43. Биггс Л.С., Миккола М.Л. Ранние индуктивные события в морфогенезе эктодермального придатка. Semin Cell Dev Biol. 2014; 25–26: 11–21.
  44. 44. Дарвин С. Изменение животных и растений при одомашнивании. Лондон: Джон Мюррей; 1875.
  45. 45. Писпа Дж., Теслефф И. Механизмы эктодермального органогенеза.Dev Biol. 2003. 262: 195–205. pmid: 14550785
  46. 46. Kandyba E, Leung Y, Chen Y-B, Widelitz R, Chuong C-M, Kobielak K. Конкурентный баланс внутрибукулярной передачи сигналов BMP / Wnt показывает надежную генную сеть, управляющую гомеостазом стволовых клеток и циклической активацией. Proc Natl Acad Sci U S. A. 2013; 110: 1351–1356. pmid: 23292934
  47. 47. Берри Ф. Б., Скари Дж. М., Мирзаянс Ф., Фортин И., Хадсон Т. Дж., Раймонд В. и др. FOXC1 необходим для жизнеспособности клеток и устойчивости к окислительному стрессу в глазу посредством регуляции транскрипции FOXO1A.Hum Mol Genet. 2008. 17: 490–505. pmid: 17993506
  48. 48. Wang L, Siegenthaler JA, Dowell RD, Yi R. Foxc1 усиливает покой в ​​самообновляющихся стволовых клетках волосяных фолликулов. Наука. 2016; 351: 613–617. pmid: 264
  49. 49. Horsley V, Aliprantis AO, Polak L, Glimcher LH, Fuchs E. NFATc1 уравновешивает покой и пролиферацию стволовых клеток кожи. Клетка. 2008. 132: 299–310. pmid: 18243104
  50. 50. Naveau A, Seidel K, Klein OD. Зуб, волосы и когти: сравнение ниш эпителиальных стволовых клеток эктодермальных придатков.Exp Cell Res. 2014; 325: 96–103. pmid: 24530577
  51. 51. Гюнтер С., Панталена-Филхо Л., Кингсли Д.М. Формирование роста скелета модульными регуляторными элементами в гене Bmp5 . PLoS Genet. 2008; 4: e1000308. pmid: 111
  52. 52. Абжанов А, Протас М, Грант Б.Р., Грант ПР, Табин С.Дж. Bmp4 и морфологические изменения клювов у зябликов Дарвина. Наука. 2004; 305: 1462–5. pmid: 15353802
  53. 53. Альбертсон Р.К., Стрелман Дж. Т., Кочер Т.Д., Елик ПК.Интеграция и эволюция нижней челюсти цихлид: молекулярная основа альтернативных стратегий питания. Proc Natl Acad Sci U A. 2005; 102: 16287–92.
  54. 54. Mou C, Pitel F, Gourichon D, Vignoles F, Tzika A, Tato P и др. Скрытый узор на коже птиц дает возможность для развития потери оперения шеи. PLoS Biol. 2011; 9: e1001028. pmid: 21423653
  55. 55. King MC, Wilson AC. Эволюция на двух уровнях у человека и шимпанзе. Наука. 1975. 188: 107–116.pmid: 10
  56. 56. Hoekstra HE, Hirschmann RJ, Bundey RA, Insel PA, Crossland JP. Мутация одной аминокислоты вносит свой вклад в адаптивный цветовой рисунок пляжных мышей. Наука. 2006; 313: 101–104. pmid: 16825572
  57. 57. Стерн Д.Л., Франкель Н. Структура и эволюция регулирующих регионов cis : история shavenbaby . Philos Trans R Soc Lond B Biol Sci. 2013; 368: 20130028. pmid: 24218640
  58. 58. Фергюсон, Калифорния, Такер А.С., Кристенсен Л., Лау А.Л., Мацук М.М., Шарп П.Т.Активин является важным ранним мезенхимальным сигналом в развитии зубов, который необходим для формирования зубного ряда мышей. Genes Dev. 1998; 12: 2636–2649. pmid: 9716414
  59. 59. Ferguson CA, Tucker AS, Heikinheimo K, Nomura M, Oh P, Li E и др. Роль эффекторов сигнального пути активина, рецепторов активина IIA и IIB и Smad2 в формировании паттерна развития зубов. Разработка. 2001; 128: 4605–4613. pmid: 11714685
  60. 60. Ока С., Ока К., Сюй Х, Сасаки Т., Брингас П., Чай Ю.Автономная потребность клеток в передаче сигналов TGF-бета во время дифференцировки одонтобластов и формирования дентинового матрикса. Mech Dev. 2007. 124: 409–415. pmid: 17449229
  61. 61. Bei M, Maas R. FGFs и BMP4 индуцируют как Msx1 -независимые, так и Msx1 -зависимые сигнальные пути в раннем развитии зубов. Разработка. 1998; 125: 4325–4333. pmid: 9753686
  62. 62. Chen Y, Bei M, Woo I, Satokata I, Maas R. Msx1 контролирует индуктивную передачу сигналов в морфогенезе зубов млекопитающих.Разработка. 1996; 122: 3035–44. pmid: 8898217
  63. 63. Вайнио С., Караванова И., Джоветт А., Теслефф И. Идентификация BMP-4 как сигнала, опосредующего вторичную индукцию между эпителиальными и мезенхимальными тканями во время раннего развития зубов. Клетка. 1993; 75: 45–58. pmid: 8104708
  64. 64. Хендриган Г. Р., Ричман Дж. М.. Сеть сигнальных путей Wnt, hedgehog и BMP регулирует замену зубов у змей. Dev Biol. 2010; 348: 130–41. pmid: 20849841
  65. 65.Хендриган Г. Р., Люнг К. Дж., Ричман Дж. М.. Идентификация предполагаемых зубных эпителиальных стволовых клеток у ящерицы с пожизненной заменой зубов. Разработка. 2010; 137: 3545–9. pmid: 20876646
  66. 66. Ву П, Ву Х, Цзян Т.-Х, Эльси Р.М., Темпл Б.Л., Дайверс С.Дж. и др. Специализированная ниша для стволовых клеток позволяет многократно обновлять зубы аллигатора. Proc Natl Acad Sci U S. A. 2013; 110: E2009–2018. pmid: 23671090
  67. 67. Купер Р.Л., Мартин К.Дж., Раш Л.Дж., Фрейзер Г.Дж. Развитие древнего эпителиального придатка: передача сигналов FGF регулирует раннее формирование зубцов хвоста у акул.EvoDevo. 2017; 8: 8. pmid: 28469835
  68. 68. Глейзер AM, Клевес PA, Erickson PA, Lam AY, Miller CT. Параллельные генетические особенности развития лежат в основе эволюции жаберной колюшки. EvoDevo. 2014; 5:19. Pmid: 24851181
  69. 69. Ли Х, Дурбин Р. Быстрое и точное согласование короткого чтения с преобразованием Барроуза-Уиллера. Bioinforma Oxf Engl. 2009; 25: 1754–1760. pmid: 19451168
  70. 70. Глейзер AM, Киллингбек Э., Митрос Т., Рохсар Д.С., Миллер СТ.Улучшение сборки генома и картирование конвергентно эволюционирующих признаков скелета колюшки с помощью генотипирования путем секвенирования. G3. 2015; 5: 1463–1472. pmid: 26044731
  71. 71. Ли Х, Хандакер Б., Вайсокер А., Феннелл Т., Руан Дж., Гомер Н. и др. Формат Sequence Alignment / Map и SAMtools. Bioinforma Oxf Engl. 2009. 25: 2078–2079. pmid: 19505943
  72. 72. ДеПристо М.А., Бэнкс Э., Поплин Р., Гаримелла К.В., Магуайр Дж. Р., Хартл С. и др. Структура для обнаружения вариаций и генотипирования с использованием данных секвенирования ДНК следующего поколения.Нат Жене. 2011; 43: 491–498. pmid: 21478889
  73. 73. Маккенна А., Ханна М., Бэнкс Э., Сиваченко А., Цибульскис К., Керницкий А. и др. Набор инструментов для анализа генома: платформа MapReduce для анализа данных секвенирования ДНК следующего поколения. Genome Res. 2010; 20: 1297–1303. pmid: 20644199
  74. 74. Ван дер Аувера Г.А., Карнейро М.О., Хартл С., Поплин Р., Дель Анхель Г., Леви-Самогон А. и др. От данных FastQ до вызовов вариантов с высокой степенью достоверности: конвейер лучших практик Genome Analysis Toolkit.Curr Protoc Bioinforma. 2013; 43: 11.10.1–33. pmid: 25431634
  75. 75. Камачо К., Кулурис Дж., Авагян В., Ма Н., Пападопулос Дж., Билер К. и др. BLAST +: архитектура и приложения. BMC Bioinformatics. 2009; 10: 421. pmid: 20003500
  76. 76. Трансгенез Каваками К. и методы генной ловушки у рыбок данио с использованием мобильного элемента Tol2. Методы Cell Biol. 2004. 77: 201–222.
  77. 77. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, et al.Эффективный дизайн и сборка пользовательских TALEN и других эффекторных конструкций на основе TAL для нацеливания на ДНК. Nucleic Acids Res. 2011; 39: e82. pmid: 21493687
  78. 78. Дойл Э.Л., Бухер Н.Дж., Стэндаж Д.С., Войтас Д.Ф., Брендель В.П., Вандик Дж.К. и др. TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: инструменты для проектирования эффекторов TAL и прогнозирования целей. Nucleic Acids Res. 2012; 40: W117–122. pmid: 22693217
  79. 79. Добин А., Дэвис К.А., Шлезингер Ф., Дренкоу Дж., Залески С., Джа С. и др.STAR: сверхбыстрый универсальный выравниватель RNA-seq. Bioinforma Oxf Engl. 2013; 29: 15–21. pmid: 23104886
  80. 80. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ и др. Сборка и количественное определение транскриптов с помощью RNA-Seq выявляет неаннотированные транскрипты и переключение изоформ во время дифференцировки клеток. Nat Biotechnol. 2010. 28: 511–515. pmid: 20436464
  81. 81. Trapnell C, Hendrickson DG, Sauvageau M, Goff L, Rinn JL, Pachter L. Дифференциальный анализ регуляции генов при разрешении транскриптов с помощью RNA-seq.Nat Biotechnol. 2013; 31: 46–53. pmid: 23222703
  82. 82. Иден Э., Липсон Д., Йогев С., Яхини З. Обнаружение мотивов в ранжированных списках последовательностей ДНК.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *